Untitled
Anonymous
c_cpp
08/21/2024 7:51 PM
51.5 KB
22
Indexable
#include <iostream>
#include <random>
#include <string>
#include<set>
#include<fstream>
#include<algorithm>
#include<iomanip>
#include<map>
#include "mpfr.cpp"
using namespace std;
int hd_s_tau[1000][1000];
string type_map[] = {"random", "stress_random_lenk", "stress_ACGT", "stress_AC", "stress_A"};
//RESULTS
double estimator;
double error_term;
int type = 1;
bool ERROR = false;
// long double pow(long double base, int exp){
// double val = pow(base, exp);//long double)
// //cout<< base<< "^" << exp<<"=" <<val<<endl;
// if(abs(base)>0 && abs(base)<1 && exp>0 && val > base){
// cout<<"error pow "<<val<<endl;
// throw ("error");
// }
// if(val != 0.0 && val < std::numeric_limits<long double>::min()){
// cout<<"underflow "<<val<<endl;
// throw std::underflow_error("underflow");
// }
// return val;
// }
long double pow(double base, int exp){
// HiPrecPow hpp;
// return hpp.compute_pow(base, exp);
try{
long double val = std::pow(base, exp); //(double)exp
//cout<< base<< "^" << exp<<"=" <<val<<endl;
if(abs(base)>0 && abs(base)<1 && exp>0 && val > base){
cerr<<"ERROR: error pow "<<val<<endl;
ERROR = true;
//throw ("error");
}
if(val != 0.0 && val < std::numeric_limits<long double >::min()){
cerr<<"ERROR: underflow => " <<base<< "^" << exp <<"="<<val<<endl;
ERROR = true;
//throw std::underflow_error("underflow");
}
double positive_infinity = std::numeric_limits<double>::infinity();
double negative_infinity = -std::numeric_limits<double>::infinity();
double not_a_number = std::numeric_limits<double>::quiet_NaN();
if(val == positive_infinity || val == negative_infinity || val == not_a_number){
cerr<<"ERROR: inf => " <<base<< "^" << exp <<"="<<val<<endl;
ERROR = true;
}
return val;
}catch(const std::exception& e){
cerr<<"ERROR: pow "<<e.what()<<endl;
ERROR = true;
//throw 1;
}
return 0;
}
namespace ValidationExamples{
static const int NUM_EXAMPLES = 4;
static const string strings[NUM_EXAMPLES] = {"AAAAAAAAA","ACGAACGAAA", "ACGTACGTAA","ACACACACAA"};
static const string taus[NUM_EXAMPLES] = {"AAA", "AACG", "ACGT", "ACAA"};
static const int ks[NUM_EXAMPLES] = {3,4, 4,4};
static const double rs[NUM_EXAMPLES] = {0.01, 0.01, 0.01, 0.05};
static const double results_sds1000[NUM_EXAMPLES] = {0.770130, 0.193595, 0.275141, 0.413365};
};
class VarianceTest {
public:
VarianceTest(std::string S, std::string tau, int k, double r) : S(S), tau(tau), k(k), r(r) {}
VarianceTest(int EXAMPLE_ID) : EXAMPLE_ID(EXAMPLE_ID) {}
VarianceTest() {}
void doIt(int EXAMPLE_ID) {
this->S = ValidationExamples::strings[EXAMPLE_ID];
this->tau = ValidationExamples::taus[EXAMPLE_ID];
this->k = ValidationExamples::ks[EXAMPLE_ID];
this->r = ValidationExamples::rs[EXAMPLE_ID];
this->EXAMPLE_ID = EXAMPLE_ID;
doIt();
}
void doIt() {
//int EXAMPLE_ID = 0;
// Initialize the variables
// this->S = ValidationExamples::strings[EXAMPLE_ID];
// this->tau = ValidationExamples::taus[EXAMPLE_ID];
// this->k = ValidationExamples::ks[EXAMPLE_ID];
// this->r = ValidationExamples::rs[EXAMPLE_ID];
int n = S.length();
int L = n - k + 1;
double p = r / (3 * (1 - r));
double rr = pow(1 - r, k);
double sum1 = 0;
double sum2 = 0;
double sum3 = 0;
double temp = 0;
for (int i = 0; i <= n - k; ++i) {
int h1 = H(i);
sum1 += (rr * pow(p, h1) - rr * rr * pow(p * p, h1));
temp = 0;
for (int j = i + 1; j <= i + k - 1; ++j) {
if (j > n - k) continue;
int h2 = H(j);
sum2 += rr * rr * pow(p, h1) * pow(p, h2);
temp += rr * rr * pow(p, h1) * pow(p, h2);
int delta = k - (j - i);
std::string over = overlap(delta);
if (over.empty())
continue;
int h3 = H(i, 2 * k - delta, over);
sum3 += pow(1 - r, 2 * k - delta) * pow(p, h3);
}
}
sum2 *= 2;
sum3 *= 2;
double sd = std::sqrt(sum1 - sum2 + sum3);
std::printf("Computed: %.6f\n", std::sqrt(sum1 - sum2 + sum3));
if(EXAMPLE_ID!=-1)
cout<<"Expected: "<<ValidationExamples::results_sds1000[EXAMPLE_ID]<<endl;
// std::printf("%.10f %.10f %.10f\n", sum1, sum2, sum3);
}
private:
std::string S;
std::string tau;
int k;
double r;
int EXAMPLE_ID = -1;
std::string overlap(int delta) {
bool o = true;
for (int i = k - delta; i < k; ++i) {
if (tau[i] != tau[i - k + delta]) {
o = false;
break;
}
}
if (!o)
return "";
else
return tau + tau.substr(delta, k - delta);
}
int H(int i, int l, const std::string& over) {
int h = 0;
for (int j = 0; j < l; ++j) {
if (S[i + j] != over[j])
++h;
}
return h;
}
int H(int i) {
int h = 0;
for (int j = 0; j < k; ++j) {
if (S[i + j] != tau[j])
++h;
}
return h;
}
};
class FastHammingDistance{
public:
string zodd="";
string zeven="";
uint64_t zodd_t, zeven_t;
void hammingDistanceGlobalSet(int K){
for (int i = 0; i < K+2; ++i) { //i<32 for K=30
zodd += "01";
}
for (int i = 0; i < K+2; ++i) {
zeven += "10";
}
zodd_t = std::stoull(zodd, nullptr, 2);
zeven_t = std::stoull(zeven, nullptr, 2);
}
};
class SimParams{
public:
int k;
unsigned long L;
double r;
SimParams(){
}
SimParams(int k, unsigned long L, double r){
this->k = k;
this->L = L;
this->r = r;
}
double get_one_minus_q(){
return pow(1.0-r, k);
//(1 − r)^k
}
double get_q(){
return 1 - pow(1.0-r, k);
//1 − (1 − r)^k
}
double get_p(){
return r/3.0/(1-r);
}
unsigned long get_n(){
return L+k-1;
}
};
std::string encode_kmer(const std::string& kmer) {
std::string encoded_kmer;
for (char base : kmer) {
switch (base) {
case 'A':
encoded_kmer += "00"; // 'A' is encoded as 00
break;
case 'C':
encoded_kmer += "01"; // 'C' is encoded as 01
break;
case 'G':
encoded_kmer += "10"; // 'G' is encoded as 10
break;
case 'T':
encoded_kmer += "11"; // 'T' is encoded as 11
break;
default:
throw std::invalid_argument("Invalid character in k-mer: " + std::string(1, base));
}
}
return encoded_kmer;
}
vector<uint64_t> stringToBinaryVec(string kmer){
int K = kmer.length();
string bv_line = encode_kmer(kmer);
vector<uint64_t> curr_bv(ceil(K/32));
for (int i = 0; i< ceil(K/32); i++){
if(2*K>i*64){
curr_bv[i] = std::stoull(bv_line.substr(64*i,std::min(64, 2*K-i*64)), nullptr, 2);
}
}
return curr_bv;
}
uint64_t stringToBinary(string kmer){
string bv_line = encode_kmer(kmer);
int K = kmer.length();
uint64_t curr_bv_lo = std::stoull(bv_line.substr(0,std::min(64, 2*K)), nullptr, 2);
return curr_bv_lo;
}
std::string generateRandomString(int length, unsigned int seed=0) {
const std::string charset = "ACGT"; // Characters to choose from
std::random_device rd;
std::mt19937 gen(rd());
//std::mt19937 gen(seed); to set seed
std::uniform_int_distribution<> dis(0, charset.length() - 1);
std::string randomString;
randomString.reserve(length);
for (int i = 0; i < length; ++i) {
randomString += charset[dis(gen)];
}
return randomString;
}
std::string generateMutatedString(string s, double r=0.1) {
string notT = "ACG";
string notG = "ACT";
string notC = "AGT";
string notA = "CGT";
std::random_device rd;
std::mt19937 gen(rd());
std::string mutatedString;
mutatedString.reserve(s.length());
for (int i = 0; i < s.length(); ++i) {
std::uniform_real_distribution<> dis1(0.0, 1.0);
// std::uniform_real_distribution<> dis2(0.0, 1.0);
// std::uniform_real_distribution<> dis3(0.0, 1.0);
double random_value = dis1(gen);
//cout<<i<<" "<<random_value<<" "<<(1-r)<<endl;
if (random_value < (1-r)) {
mutatedString += s[i]; // Same with probability (1-r) //stay same
} else {
std::uniform_int_distribution<> dis(0, 2); // Range: {0, 1, 2}
if(s[i] == 'A'){
mutatedString += notA[dis(gen)];
}else if(s[i] == 'C'){
mutatedString += notC[dis(gen)];
}else if(s[i] == 'G'){
mutatedString += notG[dis(gen)];
}else if(s[i] == 'T'){
mutatedString += notT[dis(gen)];
}
}
}
return mutatedString;
}
// Function to calculate the probability that a standard normal variable > c
double probability_greater_than(double c) {
double cdf_c = 0.5 * (1 + std::erf(c / std::sqrt(2))); // Calculate the CDF of the standard normal distribution at c
//cout<<"Z"<<1.0 - cdf_c<<endl; // The probability that a standard normal variable > c
return 1.0 - cdf_c;
}
set<string> kspectrum(string s, int k){
set<string> kmers;
for(int i=0; i<s.length()-k+1; i++){
string kmer = s.substr(i, k);
kmers.insert(kmer);
}
return kmers;
}
int hammingDist(string str1, string str2)
{
int i = 0, count = 0;
while (str1[i] != '\0') {
if (str1[i] != str2[i])
count++;
i++;
}
return count;
}
void tau_join(string kmer, vector<string>& retvec){
int k = kmer.length();
for (int delta = 1; delta<=k; delta++){ // <= k
bool isOverlap = true;
for(int j = delta-1; j>=0; j--){
if(kmer[j]!=kmer[k-delta+j]){
isOverlap = false;
break;
}
}
if(isOverlap){
if(delta==k){
retvec.push_back(kmer);
}else{
retvec.push_back(kmer+kmer.substr(delta, k-delta));
}
//len=|K|+|K|-delta
//
}
// kmer[0] == kmer[k-1]
// kmer[0] = kmer[k-2]
// kmer[1] = kmer[k-1]
// kmer[0] = kmer[k-3]
// kmer[1] = kmer[k-2]
// kmer[2] = kmer[k-1]
}
}
void value_checker(double val){
if(val != 0.0 && val < std::numeric_limits<double>::min()){
cout<<"underflow "<<val<<endl;
throw std::underflow_error("underflow");
}
if(std::isinf(val)){
cout<<"overflow "<<val<<endl;
throw std::overflow_error("overflow");
}
}
string generateStressTestString(int length, int k){
std::string pattern = "ACGT";
if(type == 1){
pattern = generateRandomString(k);
}else if(type == 2){
pattern = "ACGT";
}else if(type == 3){
pattern = "AC";
}else if(type == 4){
pattern = "A";
}
std::string s = "";
std::string result;
for (int i = 0; i < k; ++i) {
result += pattern[i % pattern.length()];
}
for (int i = 0; i < floor(length/k); ++i) {
s += result;
}
int patlen = s.length();
for (int i = 1; i <= length-patlen; ++i) {
s += "A";
}
//cout<<length<<" " << s.length()<<" "<<"stress test str"<<s<<endl;
return s;
}
int intersect_size(string s, string t, int k){
set<string> set1 = kspectrum(s, k);
set<string> set2 = kspectrum(t, k);
std::vector<string> intersect;
std::set_intersection(set1.begin(), set1.end(),
set2.begin(), set2.end(),
std::back_inserter(intersect));
return intersect.size();
}
string readString(string filename){
string randomString;
std::ifstream file(filename);
if (file.is_open()) {
if (std::getline(file, randomString)) {
//std::cout << "Line read from file: " << line << std::endl;
//L = randomString.length();
} else {
std::cerr << "File is empty." << std::endl;
}
file.close();
} else {
std::cerr << "Unable to open file." << std::endl;
}
return randomString;
}
string readSubstring(string filename, int L){
std::ifstream file(filename);
std::string line;
if (file.is_open()) {
file.seekg(0, std::ios::end); // Get the size of the file
std::streampos fileSize = file.tellg();
file.seekg(0, std::ios::beg);
//std::srand(std::time(nullptr)); // Generate a random starting position within the file
std::streampos startPos = (std::rand() % (int(fileSize) - L));
// Move to the random starting position
file.seekg(startPos);
// Read 100 characters from the file
char buffer[L+1]; // Buffer to hold 100 characters + null terminator
file.read(buffer, L);
buffer[L] = '\0'; // Null terminate the string
// Assign the buffer content to the string
line = buffer;
//cout<< "sp" << startPos << " " <<std::rand() <<endl;
//std::cout << "Random "<< L <<" characters from the file: " << line << std::endl;
file.close(); // Close the file
} else {
std::cerr << "Unable to open file." << std::endl;
}
return line;
}
class ResultAggregator{
public:
vector<int> isizes;
double isize_mean;
double isize_sd;
vector<double> test_vals_xtau;
double test_vals_xtau_mean;
double test_vals_xtau_sd;
//vector<string> labels = {"r", "L","k", "num_reps", "estimate", "mean", "sd", "variance", "abs_error", "rel_error", "fixed_tau"};
string labels[9] = {"r", "L","k", "num_reps", "estimate", "mean", "sd", "variance", "fixed_tau"};
vector<string> values;
template<typename T>
void put_values(T v){
values.push_back(to_string(v));
}
// = {"num_reps", "estimate", "mean", "sd", "variance", "abs_error", "rel_error"};
double relative_error(double estimate, double mean){
return abs((estimate-mean)/mean);
}
void diffReport(int num_replicates, double estimate, double mean, double sd, double r, int L, int k, string fixed_tau){
put_values(r);
put_values(L);
put_values(k);
put_values(num_replicates);
put_values(estimate);
put_values(mean);
put_values(sd);
put_values(sd*sd);
// put_values(abs(estimate-mean));
// put_values(relative_error(estimate, mean));
values.push_back(fixed_tau);
for(int i = 0; i< 9; i++){
std::cout << std::fixed << std::setprecision(2);
cout<<labels[i]<<" "<<values[i]<<" ";
}
cout<<endl;
/*
for(int i = 0; i< labels.size(); i++){
cout<<values[i]<<" ";
}
cout<<endl;
*/
//cout<<"num_reps "<< num_replicates<< " estimate "<<estimate<<" mean "<<mean<<" sd "<<sd<<" variance "<<sd*sd<<" abs_error "<<abs(estimate-mean)<<" rel_error "<<relative_error(estimate, mean)<<endl;
}
double calculateMean(const std::vector<int>& numbers) {
double sum = 0.0;
for (const auto& num : numbers) {
sum += num;
}
return sum / numbers.size();
}
double calculateMean(const std::vector<double>& numbers) {
double sum = 0.0;
for (const auto& num : numbers) {
sum += num;
}
return sum / numbers.size();
}
double calculateStandardDeviation(const std::vector<int>& numbers) {
double mean = calculateMean(numbers);
double squaredDiffSum = 0.0;
for (const auto& num : numbers) {
double diff = num - mean;
squaredDiffSum += diff * diff;
}
double variance = squaredDiffSum / numbers.size();
return std::sqrt(variance);
}
double calculateStandardDeviation(const std::vector<double>& numbers) {
double mean = calculateMean(numbers);
double squaredDiffSum = 0.0;
for (const auto& num : numbers) {
double diff = num - mean;
squaredDiffSum += diff * diff;
}
double variance = squaredDiffSum / numbers.size();
return std::sqrt(variance);
}
void calculateMeanSD(const std::vector<int>& numbers, double& mean, double& sd) {
mean = calculateMean(numbers);
double squaredDiffSum = 0.0;
for (const auto& num : numbers) {
double diff = num - mean;
squaredDiffSum += diff * diff;
}
double variance = squaredDiffSum / numbers.size();
sd = std::sqrt(variance);
}
void calculateMeanSD(const std::vector<double>& numbers, double& mean, double& sd) {
mean = calculateMean(numbers);
double squaredDiffSum = 0.0;
for (const auto& num : numbers) {
double diff = num - mean;
squaredDiffSum += diff * diff;
}
double variance = squaredDiffSum / numbers.size();
sd = std::sqrt(variance);
}
};
class Thm11 {
public:
Thm11() {}; // Provide a definition for the default constructor
int k = 8;
double r = 0.01;
unsigned long L = 17;
int n = L+k-1;
int fixed_tau_index_j = 0;
//set by call to init
string fixed_string_s;
SimParams sim;
vector< map<int, string> > tau_joins_by_delta;
int hd_s_tau[1000][1000];
string fixed_tau;
int unique = 0;
//saved 1 : string: TACGTACGAA, tau ACGA
int get_hd_s_tau(int i, int j){
if(i>=L || j>=unique){
cout<<"Error: get_hd_s_tau out of bounds: i, j, L, unique: "<<i << " "<< j<<" "<<L<<" "<<unique<<endl;
throw std::invalid_argument("Error: get_hd_s_tau out of bounds");
}
return hd_s_tau[i][j];
}
void set_hd_s_tau(int i, int j, int val){
if(i>=L || j>=unique){
cout<<"Error: get_hd_s_tau out of bounds: i, j, L, unique: "<<i << " "<< j<<" "<<L<<" "<<unique<<endl;
throw std::invalid_argument("Error: set_hd_s_tau out of bounds");
}
hd_s_tau[i][j] = val;
}
void precompute_si_tau_hd_result_thm11(SimParams& sim, string& s){
// // // PHASE1: INIT
this->k = sim.k;
this->r = sim.r;
// double p = sim.get_p();
// int L = s.length() - k + 1;
this->n = s.length();
this->L = n - k + 1;
double p = r / (3 * (1 - r));
double rr = pow(1 - r, k);
set<string> set1 = kspectrum(s, k);
std::vector<string> s_vector(set1.begin(), set1.end());
this->unique = s_vector.size();
//populate tau_joins
std::vector< vector<string> > tau_joins(s_vector.size());
for(int j = 0 ; j < s_vector.size(); j++ ){
string tau = s_vector[j]; //FiX
tau_join(tau, tau_joins[j]);
}
tau_joins_by_delta.resize(s_vector.size());
for(int j = 0 ; j < s_vector.size(); j++ ){
string tau = s_vector[j]; //FiX
for(string &s : tau_joins[j]){
int delta = 2*k - s.length(); //2*k - s.length();
// cout<<":::" << delta<<" "<<s<<endl;
tau_joins_by_delta[j][delta] = s;
}
}
//populate hd_s_tau
for (int i = 0; i <= s.length() - k; ++i) {
string s_i = (s.substr(i, k));
for(int j = 0 ; j < s_vector.size(); j++ ){
string tau = s_vector[j]; //FiX
set_hd_s_tau(i, j, hammingDist(s_i, tau));
//hd_s_tau[i][j] = hammingDist(s_i, tau);
}
}
// // // PHASE2: Compute estimate of intersection
double sum_pr = 0;
double sum_e_max_tau = 0;
for(int j = 0 ; j<s_vector.size(); j++){ // not on I, length of |sp(s)| -> so tau = s_vector[j]
//string s_tau = s_vector[j];
double sum_top = 0;
double vcomp_sum1 = 0;
double vcomp_sum2 = 0;
double vcomp_sum3 = 0;
double vcomp_temp = 0;
for (int i = 0; i <= n - k; ++i) {
//PHASE1: do sum top
double pp = pow(p, get_hd_s_tau(i,j));
double pp2 = pow(pp,2);
sum_top -= pp;
// PHASE2: do sum bottom (sd)
// double sum_bottom1 = 0;
// double sum_bottom2 = 0;
// double sum_bottom2_p1 = 0;
// double sum_bottom2_p2 = 0;
int h1 = get_hd_s_tau(i,j);
vcomp_sum1 += (rr * pow(p, h1) - rr * rr * pow(p * p, h1));
vcomp_temp = 0;
for (int delta_o = i + 1; delta_o <= i + k - 1; ++delta_o) {
if (delta_o > n - k) continue; //fixing it : L-1 max value n-k+1 -1 = n-k
int h2 = get_hd_s_tau(delta_o,j); //H(delta_o);
vcomp_sum2 += rr * rr * pow(p, h1) * pow(p, h2);
vcomp_temp += rr * rr * pow(p, h1) * pow(p, h2);
int delta = k - (delta_o - i);
std::string over="";
if(tau_joins_by_delta[j].count(delta)>0){
over = tau_joins_by_delta[j][delta]; // overlap(delta);
}
if (over=="")
continue;
int h3 = hammingDist(s.substr(i, 2 * k - delta), over); //H(i, 2 * k - delta, over);
vcomp_sum3 += pow(1 - r, 2 * k - delta) * pow(p, h3);
}
}
vcomp_sum2 *= 2;
vcomp_sum3 *= 2;
double sd = std::sqrt(vcomp_sum1 - vcomp_sum2 + vcomp_sum3);
//Finalized bottom for inner loop
//cout<<":::"<<"sd: "<<sd<<" "<<s_vector[j]<<endl;
sum_top *= rr;
//Finalized top for inner loop
sum_pr += probability_greater_than(sum_top / sd);
//sum_pr over all tau
const double pi = M_PI; // Value of pi
double term1 = pow(2.0 / pi, 1.0 / 4.0);
double term2 = pow(2 * k, 2.0) * L / pow(sd, 3.0);
double term3 = sqrt(28.0) * pow(2 * k, 1.5) * sqrt(L) / (sqrt(pi) * pow(sd, 2.0));
double e_max_tau = term1 * sqrt(term2 + term3);
//Finalized e_max_tau for inner loop
sum_e_max_tau += e_max_tau;
//sum_e_max_tau over all tau
/*
for(int i = 0; i< L; i++){
double pp=pow(p, hd_s_tau[i][j]);
double pp2 = pow(pp,2);
sum_top -= pp;
sum_bottom1 += pp/sim.get_one_minus_q() - pp2;
//sum_bottom1 += pp/();
for(int delta = 1; delta<=k; delta++){
// if(i+delta>=L){
// break;
// }
sum_bottom2_p1+= -2*pow(p, hd_s_tau[i][j] + hd_s_tau[i+k-delta][j] );
//cout<<sum_bottom2_p1<<" sp "<< " delta " << delta << " k "<<k<< " "<< hd_s_tau[i][j] << " "<< hd_s_tau[i+delta][j] << " " << i+delta<<endl;
}
for (int t = 0; t< tau_joins[j].size(); t++){
string joinedString = tau_joins[j][t];
int delta = 2*k - joinedString.length();//len = 2k -delta
//sum_bottom2+= -2*pow(p, hd_s_tau[i][j] + hd_s_tau[i+delta][j] );
string s_i_len_same_as_joinedString = s.substr(i, joinedString.length() );
if(s_i_len_same_as_joinedString.length()==joinedString.length() && delta!=k){
int d = hammingDist(s_i_len_same_as_joinedString, joinedString);
sum_bottom2_p2 += 2*pow(p,d)/(pow(1-r, delta));
}
}
}
sum_bottom2= sum_bottom2_p1 + sum_bottom2_p2;
cout<<"for tau "<<j<<" "<<s_vector[j]<<endl;
cout<<"sum top = "<<sum_top<<endl;
cout<<"sum b1 = "<<sum_bottom1<<endl;
cout<<"sum b2 p1 = "<<sum_bottom2_p1<<endl;
cout<<"sum b2 p2 = "<<sum_bottom2_p2<<endl;
cout<<"sum b2 ="<<sum_bottom2<<endl;
cout<<"sum_top / sqrt(sum_bottom1 + sum_bottom2 = "<<sum_top / sqrt(sum_bottom1 + sum_bottom2)<<endl;
if (std::isinf(sum_bottom2_p1) && sum_bottom2_p1 < 0) {
cout<<"Error "<<j<<" "<< s_vector[j]<<endl;
exit(1);
}
double sigma_tau = sqrt(sum_bottom1 + sum_bottom2); //variance of tau
const double pi = M_PI; // Value of pi
double term1 = pow(2.0 / pi, 1.0 / 4.0);
double term2 = pow(2 * k, 2.0) * L / pow(sigma_tau, 3.0);
double term3 = sqrt(28.0) * pow(2 * k, 1.5) * sqrt(L) / (sqrt(pi) * pow(sigma_tau, 2.0));
double e_max_tau = term1 * sqrt(term2 + term3);
//cout<<term1<<" "<<term2<<" "<<term3<<" "<<e_max_tau<<endl;
sum_e_max_tau += e_max_tau;
sum_pr += probability_greater_than(sum_top / sqrt(sum_bottom1 + sum_bottom2));
*/
}
estimator = sum_pr;
error_term = sum_e_max_tau;
}
double compute_sd_estimate(){
//PART1:: INIT
// fixed_string_s = readSubstring("/Users/amatur/code/downloads/t2t_chr21.sset", L+k-1);
//fixed_string_s = "AGCTTAAAGTAATTATCTAGGTGTCTGTATTTG";
//fixed_string_s = "AGCTTAAAGTAATTATCTAGGTGTCTGTATTTGCCT";
vector<string> s_kspectrum_vector;
// L = fixed_string_s.length() - k + 1;
//readSubstring("/Users/amatur/code/downloads/t2t_chr21.sset", L+k-1);
type = 3;
//fixed_string_s = generateStressTestString( L+k-1, k);
fixed_string_s = generateRandomString( L+k-1);
//generateStressTestString( L+k-1, k);
//fixed_string_s = "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG";
// fixed_string_s = "ACGAACGAAA";
// L = fixed_string_s.length() - k + 1;
fixed_string_s = "AAAAAAAAA";
cout<<fixed_string_s<<endl;
sim.k = k;
sim.L = L;
sim.r = r;
set<string> set1 = kspectrum(fixed_string_s, k);
std::vector<string> s_vector(set1.begin(), set1.end());
s_kspectrum_vector = s_vector;
fixed_tau = s_kspectrum_vector[fixed_tau_index_j];
if(fixed_tau_index_j > s_kspectrum_vector.size()){
cout<<"Error: fixed_tau_index_j out of bounds"<<" " <<fixed_tau_index_j<<endl;
exit(1);
}
vector< vector<string> > tau_joins;
tau_joins.resize(s_kspectrum_vector.size());
for(int j = 0 ; j < s_kspectrum_vector.size(); j++ ){
string tau = s_kspectrum_vector[j]; //FiX
tau_join(tau, tau_joins[j]);
}
for(int j = 0 ; j < s_kspectrum_vector.size(); j++ ){
string tau = s_kspectrum_vector[j]; //FiX
for(string &s : tau_joins[j]){
int delta = 2*k - s.length(); //2*k - s.length();
tau_joins_by_delta[j][delta] = s;
}
}
for (int i = 0; i < fixed_string_s.size(); ++i) {
string s_i = (fixed_string_s.substr(i, k));
//for(int j = 0 ; j < s_kspectrum_vector.size(); j++ ){
for(int j = fixed_tau_index_j ; j <= fixed_tau_index_j; j++ ){
string tau = s_kspectrum_vector[j]; //FiX
hd_s_tau[i][j] = hammingDist(s_i, tau);
//tau_join(tau, tau_joins[j]);
}
}
//PART2:: COMPUTE
double p = sim.get_p();
double sigma_tau = 777777;
//fix a tau: j = 0
for(int j = fixed_tau_index_j ; j<=fixed_tau_index_j; j++){ // not on I, length of |sp(s)|
double sum_top = 0;
double sum_bottom1 = 0;
double sum_bottom2 = 0;
double sum_bottom2_p1 = 0;
double sum_bottom2_p2 = 0;
set<int> delta_taus;
for (int t = 0; t< tau_joins[j].size(); t++){
delta_taus.insert(2*k - tau_joins[j][t].length());
}
int coutcounter=0;
for(int i = 0; i< L; i++){
double pp = pow(p, hd_s_tau[i][j]);
double pp2 = pow(pp,2);
sum_top -= pp;
sum_bottom1 += pp/sim.get_one_minus_q() - pp2;
//sum_bottom1 += pp/();
int t = tau_joins[j].size()-1;
string joinedString = tau_joins[j][t];
int delta = 2*k - joinedString.length();//len = 2k -delta
for(int o = 1; o <= k-1; o++){
if(L-i-1 < o){
cout<<"SHOUDL NOT HAPPEN"<<endl;
break;
}
sum_bottom2_p1+= -2*pow(p, hd_s_tau[i][j] + hd_s_tau[i+k-o][j] );
//cout<<"CC" << p<<" "<< fixed_string_s.substr(i, k) << " "<< o << " hd "<< hd_s_tau[i][j] << " " << fixed_string_s.substr(i+k-o, k) <<" hd "<< hd_s_tau[i+k-o][j] <<" " << -2*pow(p, hd_s_tau[i][j] + hd_s_tau[i+k-o][j] )<<endl;
//cout<<sum_bottom2_p1<<" sp "<< " delta " << delta << " k "<<k<< " "<< hd_s_tau[i][j] << " "<< hd_s_tau[i+delta][j] << " " << i+delta<<endl;
//if(i>L+k-1 = o upper range = L - i )
/*
if(k-o == delta && t>=0){
string s_i_len_same_as_joinedString = fixed_string_s.substr(i, joinedString.length() );
if(s_i_len_same_as_joinedString.length()==joinedString.length() && delta!=k){
coutcounter++;
int d = hammingDist(s_i_len_same_as_joinedString, joinedString);
//cout<<d<< " " << i<<" "<< s_i_len_same_as_joinedString << " "<< delta << " hd "<< hd_s_tau[i][j] << " " << joinedString<<" hd "<< hd_s_tau[i+k-delta][j] <<" " << -2*pow(p, hd_s_tau[i][j] + hd_s_tau[i+k-delta][j] )<<endl;
sum_bottom2_p2 += 2*pow(p,d)*(pow(1-r, k+o));
//cout<<(pow(1-r, delta))<<endl;
}
//problem in p2
//go to next delta
t--;
if(t>=0){
joinedString = tau_joins[j][t];
delta = 2*k - joinedString.length();//len = 2k -delta
}
}
*/
//sum_bottom2+= -2*pow(p, hd_s_tau[i][j] + hd_s_tau[i+delta][j] );
//sum_bottom2_p2 += 2*pow(p,d)/(pow(1-r, delta));
}
///*
for (int t = 0; t< tau_joins[j].size(); t++){
string joinedString = tau_joins[j][t];
int delta = 2*k - joinedString.length();//len = 2k -delta
if (delta==k)
{
continue;
}
//sum_bottom2+= -2*pow(p, hd_s_tau[i][j] + hd_s_tau[i+delta][j] );
string s_i_len_same_as_joinedString ="";
if(joinedString.length() - i + 1 > 0 && i<fixed_string_s.length()){
s_i_len_same_as_joinedString = fixed_string_s.substr(i, joinedString.length() );
}
if(s_i_len_same_as_joinedString.length()==joinedString.length()){
//if(delta!=k){
coutcounter++;
int d = hammingDist(s_i_len_same_as_joinedString, joinedString);
//cout<<d<< " " << i<<" "<< s_i_len_same_as_joinedString << " "<< delta << " hd "<< hd_s_tau[i][j] << " " << joinedString<<" hd "<< hd_s_tau[i+k-delta][j] <<" " << -2*pow(p, hd_s_tau[i][j] + hd_s_tau[i+k-delta][j] )<<endl;
sum_bottom2_p2 += 2*pow(p,d)/(pow(1-r, delta));
//cout<<(pow(1-r, delta))<<endl;
}
//problem in p2
}
//*/
}
cout<<"Count "<<coutcounter<<endl;
sum_bottom2= sum_bottom2_p1 + sum_bottom2_p2;
cout<<"sum top "<<sum_top<<endl;
cout<<"sum b1 (p0) "<<sum_bottom1 / pow((1-r), 2*k) <<endl;
cout<<"sum b2 p1 "<<sum_bottom2_p1 / pow((1-r), 2*k) <<endl;
cout<<"sum b2 p2 "<<sum_bottom2_p2/ pow((1-r), 2*k) <<endl;
double a = sum_bottom1 / pow((1-r), 2*k) ;//0.201732;
double b = sum_bottom2_p1 / pow((1-r), 2*k);
//-20.712563;
//sum_bottom2_p1 / pow((1-r), 2*k) ;
//-20.712563;
double c = sum_bottom2_p2/ pow((1-r), 2*k);
//21.037053;
//
cout<<"sum b2 "<<sum_bottom2<<endl;
cout<<"sum_top / sqrt(sum_bottom1 + sum_bottom2) "<<sum_top / sqrt(sum_bottom1 + sum_bottom2)<<endl;
if (std::isinf(sum_bottom2_p1) && sum_bottom2_p1 < 0) {
cout<<"Error "<<j<<" "<< s_kspectrum_vector[j]<<endl;
exit(1);
}
//sigma_tau = pow((1-r), k) * sqrt(sum_bottom1 + sum_bottom2); //variance of tau
sigma_tau = pow((1-r), k) * sqrt(sum_bottom1 + sum_bottom2); //variance of tau
cout<<"ABC"<<sqrt(a+b+c)<<endl;
//sigma_tau = sqrt(a+b+c);
}
return sigma_tau;
}
int sum_xi_tau(string& mutated_string, string tau){
int sum = 0;
// generate all kmer from mutated_string
for (int i = 0; i <= mutated_string.length() - k; ++i) {
std::string kmer = mutated_string.substr(i, k);
if(kmer==tau){
sum+=1;
}
}
if(sum<0){
cout<<"Error: overflow: sum_xi_tau "<<sum<<endl;
exit(1);
}
return sum; //return CAPITAL-X^tau
}
};
///*
int main (int argc, char* argv[]){
// cout<<pow(1.64567e156, 1000000000)<<endl;
// exit(1);
// /*** BEGIN VARIANCE TEST ***/
// VarianceTest varianceTest;
// varianceTest.doIt(0);
// exit(1);
// /*** END VARIANCE TEST ***/
srand(time(nullptr));
// parameters to be passed by command line
// int L = -1;
// int k = -1;
// double r = -1;'
// int L = 100;
// int k = 25;
// double r = 0.01;
// type = 0;
int L = 100;
int k = 50;
double r = 0.001;
type = 0;
string filename="";
int num_replicates = 1; //do this random string generation "num_replicates" times
num_replicates=100;
vector<string> args(argv + 1, argv + argc);
for (auto i = args.begin(); i != args.end(); ++i) {
if (*i == "-h" || *i == "--help") {
cout << "Syntax: -i [input-file] -l <length>[100] -r <mutation-rate>[0.01] -t <type-of-input-string>[1] -k <kmer-size>[33] -c <num-replicates>[100]" << endl;
cout<< " Types: 0: random, 1: stress test, 2: ACGT, 3: AC, 4: A"<<endl;
return 0;
} else if (*i == "-r") {
r = stod(*++i);
} else if (*i == "-l") {
L = stoull(*++i);
} else if (*i == "-k") {
k = stoi(*++i);
} else if (*i == "-t") {
type = stoi(*++i);
}else if (*i == "-i") {
filename = (*++i);
} else if (*i == "-c") {
num_replicates = stoi(*++i);
}
}
//hammingDistanceGlobalSet(K); // if using efficient hamming distance: TODO
// /*** BEGIN EXAMPLE BYPASS COMMAND LINE ***/
// Example: ./thm11 -l 100 -k 40 -r 0.01 -c 100
// L=100;
// k=40;
// r=0;
// num_replicates=100;
// SimParams sim(k, L, r); //k, L, r
// /*** END EXAMPLE BYPASS COMMAND LINE ***/
ResultAggregator res;
std::string randomString;
//Setup the FIXED string "s" and the parameters for the simulation (string in => randomString)
SimParams sim(k, L, r); //k, L, r
filename=""; //filename="/Users/amatur/code/downloads/t2t_chr21.sset";
int length = sim.get_n();
if (filename==""){
if(type == 0){
randomString = generateRandomString(length);
}else{
randomString = generateStressTestString(length, sim.k);
}
}else{
randomString = readSubstring(filename, length);
}
// /*** BEGIN MINI TESTS ***/
// int example_id = 2;
// SimParams sim(ValidationExamples::ks[example_id], ValidationExamples::strings[example_id].length()-ValidationExamples::ks[example_id]+1, ValidationExamples::rs[example_id]); //k, L, r
// randomString = ValidationExamples::strings[example_id];
// Thm11 thm11;
// thm11.precompute_si_tau_hd_result_thm11(sim, randomString);
// exit(1);
// /*** END MINI TESTS ***/
/*** BEGIN MAIN TEST ***/
Thm11 thm11;
thm11.precompute_si_tau_hd_result_thm11(sim, randomString);
for(int i=0; i<num_replicates; i++){
std::string mutatedString = generateMutatedString(randomString, sim.r);
int Isize = intersect_size(randomString, mutatedString, sim.k);
res.isizes.push_back(Isize);
}
res.calculateMeanSD(res.isizes, res.isize_mean, res.isize_sd);
double r_prime = 1.0 - pow(2, log2( res.isize_mean)/sim.k-log2(sim.L)/sim.k);
if(ERROR){
cout<<"num_replicates "<<num_replicates<< " input_s "<< type_map[type] << " L "<<sim.L<<" r "<<sim.r<< " k "<< sim.k << " estimate " << estimator << " |I|_mean " << res.isize_mean << " |I|_sd " << res.isize_sd << " L(1-q) "<<sim.L*(1-sim.get_q())<< " r_prime " << r_prime << " theoretical_err " << error_term << " observed_err "<< abs( res.isize_mean-estimator)<< " ERROR ERROR" << endl;
}else{
cout<<"num_replicates "<<num_replicates<< " input_s "<< type_map[type] << " L "<<sim.L<<" r "<<sim.r<< " k "<< sim.k << " estimate " << estimator << " |I|_mean " << res.isize_mean << " |I|_sd " << res.isize_sd << " L(1-q) "<<sim.L*(1-sim.get_q())<< " r_prime " << r_prime << " theoretical_err " << error_term << " observed_err "<< abs( res.isize_mean-estimator)<< endl;
}
}
//*/Editor is loading...
Leave a Comment