snakemake_error

Anonymous
autohotkey
02/04/2021 7:35 PM
28.3 KB
19
Indexable
```
(base) root@workflows:~# cwl-runner workflow.cwl grist-job.yml
INFO /root/miniconda3/bin/cwl-runner 3.0.20210124104916
INFO Resolved 'workflow.cwl' to 'file:///root/workflow.cwl'
INFO [workflow ] start
INFO [workflow ] starting step summarize
INFO [step summarize] start
INFO [job summarize] /tmp/1npjtpu_$ docker \
    run \
    -i \
    --mount=type=bind,source=/tmp/1npjtpu_,target=/FmhnLf \
    --mount=type=bind,source=/tmp/5do1y41r,target=/tmp \
    --mount=type=bind,source=/root/conf-tutorial.yml,target=/var/lib/cwl/stgf21b6736-5c26-44f9-8da8-23631b652a00/conf-tutorial.yml,readonly \
    --workdir=/FmhnLf \
    --read-only=true \
    --user=0:0 \
    --rm \
    --env=TMPDIR=/tmp \
    --env=HOME=/FmhnLf \
    --cidfile=/tmp/s56_70wp/20210204192340-682179.cid \
    mlim13/ggristv2:tag2 \
    genome-grist \
    run \
    /var/lib/cwl/stgf21b6736-5c26-44f9-8da8-23631b652a00/conf-tutorial.yml \
    summarize
Building DAG of jobs...
Creating conda environment ../root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/env/papermill.yml...
Downloading and installing remote packages.
Environment for ../root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/env/papermill.yml created (location: .snakemake/conda/51038310)
Creating conda environment ../root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/env/sourmash.yml...
Downloading and installing remote packages.
Environment for ../root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/env/sourmash.yml created (location: .snakemake/conda/09af8546)
Creating conda environment ../root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/env/trim.yml...
Downloading and installing remote packages.
Environment for ../root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/env/trim.yml created (location: .snakemake/conda/ee93ae82)
Creating conda environment ../root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/env/sra.yml...
Downloading and installing remote packages.
Environment for ../root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/env/sra.yml created (location: .snakemake/conda/e9364533)
Using shell: /usr/bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Job counts:
	count	jobs
	1	adapter_trim
	1	download_adapters
	1	gather_genbank_wc
	1	kmer_trim_reads
	1	make_combined_info_csv
	1	make_notebook
	1	set_kernel
	1	summarize
	2	summarize_samtools_depth
	1	wc_download_sra
	1	wc_prefetch_gather
	1	wc_sourmash_abundtrim
	1	wc_sourmash_gather_reads
	1	wc_split_query_known_unknown
	15

[Thu Feb  4 19:27:27 2021]
rule set_kernel:
    output: outputs.tutorial/.kernel.set
    jobid: 14

Activating conda environment: /FmhnLf/.snakemake/conda/51038310
Installed kernelspec genome_grist in /FmhnLf/.local/share/jupyter/kernels/genome_grist
Collecting matplotlib
  Downloading matplotlib-3.3.4-cp39-cp39-manylinux1_x86_64.whl (11.5 MB)
Collecting numpy
  Downloading numpy-1.20.0-cp39-cp39-manylinux2010_x86_64.whl (15.4 MB)
Collecting pandas
  Downloading pandas-1.2.1-cp39-cp39-manylinux1_x86_64.whl (9.7 MB)
Collecting cycler>=0.10
  Using cached cycler-0.10.0-py2.py3-none-any.whl (6.5 kB)
Collecting pillow>=6.2.0
  Downloading Pillow-8.1.0-cp39-cp39-manylinux1_x86_64.whl (2.2 MB)
Collecting kiwisolver>=1.0.1
  Downloading kiwisolver-1.3.1-cp39-cp39-manylinux1_x86_64.whl (1.2 MB)
Requirement already satisfied: python-dateutil>=2.1 in ./.snakemake/conda/51038310/lib/python3.9/site-packages (from matplotlib) (2.8.1)
Requirement already satisfied: pyparsing!=2.0.4,!=2.1.2,!=2.1.6,>=2.0.3 in ./.snakemake/conda/51038310/lib/python3.9/site-packages (from matplotlib) (2.4.7)
Requirement already satisfied: six in ./.snakemake/conda/51038310/lib/python3.9/site-packages (from cycler>=0.10->matplotlib) (1.15.0)
Collecting pytz>=2017.3
  Using cached pytz-2021.1-py2.py3-none-any.whl (510 kB)
Installing collected packages: pytz, pillow, numpy, kiwisolver, cycler, pandas, matplotlib
Successfully installed cycler-0.10.0 kiwisolver-1.3.1 matplotlib-3.3.4 numpy-1.20.0 pandas-1.2.1 pillow-8.1.0 pytz-2021.1
Touching output file outputs.tutorial/.kernel.set.
[Thu Feb  4 19:27:38 2021]
Finished job 14.
1 of 15 steps (7%) done

[Thu Feb  4 19:27:38 2021]
rule download_adapters:
    output: inputs/adapters.fa
    jobid: 10

  % Total    % Received % Xferd  Average Speed   Time    Time     Time  Current
                                 Dload  Upload   Total   Spent    Left  Speed
100  1133  100  1133    0     0  13174      0 --:--:-- --:--:-- --:--:-- 13174
[Thu Feb  4 19:27:38 2021]
Finished job 10.
2 of 15 steps (13%) done

[Thu Feb  4 19:27:38 2021]
rule wc_download_sra:
    output: outputs.tutorial/raw/HSMA33MX_1.fastq.gz, outputs.tutorial/raw/HSMA33MX_2.fastq.gz, outputs.tutorial/raw/HSMA33MX_unpaired.fastq.gz
    jobid: 9
    wildcards: sample=HSMA33MX
    resources: mem_mb=40000

Activating conda environment: /FmhnLf/.snakemake/conda/e9364533
tmp directory: /tmp/tmp.Hk6J9IX4uw
running fastq-dump for HSMA33MX
Read 213433 spots for SRR5950647
Written 213433 spots for SRR5950647
total 107M
-rw-r--r-- 1 root root 54M Feb  4 19:27 SRR5950647_pass_1.fastq
-rw-r--r-- 1 root root 54M Feb  4 19:27 SRR5950647_pass_2.fastq
accession is SRR5950647
/FmhnLf
no unpaired; creating empty unpaired file /tmp/tmp.Hk6J9IX4uw/SRR5950647_pass.fastq for simplicity
processing R1...
processing R2...
processing unpaired
Write-protecting output file outputs.tutorial/raw/HSMA33MX_1.fastq.gz.
Write-protecting output file outputs.tutorial/raw/HSMA33MX_2.fastq.gz.
Write-protecting output file outputs.tutorial/raw/HSMA33MX_unpaired.fastq.gz.
[Thu Feb  4 19:27:59 2021]
Finished job 9.
3 of 15 steps (20%) done

[Thu Feb  4 19:27:59 2021]
rule adapter_trim:
    input: outputs.tutorial/raw/HSMA33MX_1.fastq.gz, outputs.tutorial/raw/HSMA33MX_2.fastq.gz, inputs/adapters.fa
    output: outputs.tutorial/trim/HSMA33MX_R1.trim.fq.gz, outputs.tutorial/trim/HSMA33MX_R2.trim.fq.gz, outputs.tutorial/trim/HSMA33MX_o1.trim.fq.gz, outputs.tutorial/trim/HSMA33MX_o2.trim.fq.gz
    jobid: 8
    wildcards: sample=HSMA33MX

Activating conda environment: /FmhnLf/.snakemake/conda/ee93ae82
TrimmomaticPE: Started with arguments:
 outputs.tutorial/raw/HSMA33MX_1.fastq.gz outputs.tutorial/raw/HSMA33MX_2.fastq.gz outputs.tutorial/trim/HSMA33MX_R1.trim.fq.gz outputs.tutorial/trim/HSMA33MX_o1.trim.fq.gz outputs.tutorial/trim/HSMA33MX_R2.trim.fq.gz outputs.tutorial/trim/HSMA33MX_o2.trim.fq.gz ILLUMINACLIP:inputs/adapters.fa:2:0:15 MINLEN:25 LEADING:2 TRAILING:2 SLIDINGWINDOW:4:2
Multiple cores found: Using 2 threads
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG'
Using Long Clipping Sequence: 'TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC'
Using Long Clipping Sequence: 'TTTTTTTTTTCAAGCAGAAGACGGCATACGA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
Using Long Clipping Sequence: 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT'
ILLUMINACLIP: Using 2 prefix pairs, 14 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 213433 Both Surviving: 213180 (99.88%) Forward Only Surviving: 253 (0.12%) Reverse Only Surviving: 0 (0.00%) Dropped: 0 (0.00%)
TrimmomaticPE: Completed successfully
Write-protecting output file outputs.tutorial/trim/HSMA33MX_R1.trim.fq.gz.
Write-protecting output file outputs.tutorial/trim/HSMA33MX_R2.trim.fq.gz.
Write-protecting output file outputs.tutorial/trim/HSMA33MX_o1.trim.fq.gz.
Write-protecting output file outputs.tutorial/trim/HSMA33MX_o2.trim.fq.gz.
[Thu Feb  4 19:28:11 2021]
Finished job 8.
4 of 15 steps (27%) done

[Thu Feb  4 19:28:11 2021]
rule kmer_trim_reads:
    input: outputs.tutorial/trim/HSMA33MX_R1.trim.fq.gz, outputs.tutorial/trim/HSMA33MX_R2.trim.fq.gz
    output: outputs.tutorial/abundtrim/HSMA33MX.abundtrim.fq.gz
    jobid: 7
    wildcards: sample=HSMA33MX
    resources: mem_mb=1000

Activating conda environment: /FmhnLf/.snakemake/conda/ee93ae82

|| This is the script interleave-reads.py in khmer.
|| You are running khmer version 3.0.0a3
|| You are also using screed version 1.0.5
||
|| If you use this script in a publication, please cite EACH of the following:
||
||   * MR Crusoe et al., 2015. https://doi.org/10.12688/f1000research.6924.1
||
|| Please see http://khmer.readthedocs.io/en/latest/citations.html for details.

Interleaving:
	outputs.tutorial/trim/HSMA33MX_R1.trim.fq.gz
	outputs.tutorial/trim/HSMA33MX_R2.trim.fq.gz
... 0 pairs
... 100000 pairs
... 200000 pairs
final: interleaved 213180 pairs
output written to block device

|| This is the script trim-low-abund.py in khmer.
|| You are running khmer version 3.0.0a3
|| You are also using screed version 1.0.5
||
|| If you use this script in a publication, please cite EACH of the following:
||
||   * MR Crusoe et al., 2015. https://doi.org/10.12688/f1000research.6924.1
||   * Q Zhang, S Awad, CT Brown, https://doi.org/10.7287/peerj.preprints.890v1
||
|| Please see http://khmer.readthedocs.io/en/latest/citations.html for details.


PARAMETERS:
 - kmer size =     32 		(-k)
 - n tables =      4 		(-N)
 - max tablesize = 2.5e+08 	(-x)
Estimated memory usage is 1.0 Gb (1e+09 bytes = 4 bytes x 2.5e+08 entries / 1 entries per byte)
--------
making countgraph
created temporary directory ./tmp4la9vo82khmer;
use -T to change location
... - 9760 10018 922229 205 17713
... - 18780 20004 1839542 981 82133
... - 27544 30002 2756540 1997 167212
... - 36206 40042 3677395 3100 259294
... - 44752 50024 4591807 4291 357372
... - 53094 60004 5511038 5672 472639
... - 61542 70002 6426273 6982 582370
... - 69746 80010 7345767 8505 710389
... - 77986 90004 8265626 10002 836036
... - 86248 100036 9185289 11534 966074
... - 94364 110006 10099101 13152 1101616
... - 102396 120010 11017357 14845 1244678
... - 110372 130014 11936953 16615 1393923
... - 118376 140010 12854491 18341 1538813
... - 126342 150030 13777851 20145 1689780
... - 134162 160004 14693273 22022 1849633
... - 142090 170002 15608729 23814 2001694
... - 149846 180008 16526957 25758 2165589
... - 157616 190012 17447097 27717 2331491
... - 165398 200008 18361736 29674 2497046
... - 173172 210002 19281784 31629 2663296
... - 180840 220020 20203849 33723 2842291
... - 188488 230004 21120660 35791 3018371
... - 196188 240028 22041851 37841 3191505
... - 203806 250020 22957537 39972 3372247
... - 211290 260014 23875524 42178 3559750
... - 218900 270004 24794101 44303 3740504
... - 226440 280010 25710375 46494 3927275
... - 234002 290006 26627490 48666 4111909
... - 241470 300004 27547774 50910 4302608
... - 249026 310002 28462312 53113 4490496
... - 256448 320006 29378293 55396 4685415
... - 263940 330006 30297818 57638 4876134
... - 271406 340004 31212378 59914 5066103
... - 278786 350004 32132519 62281 5268626
... - 286098 360004 33054904 64705 5476894
... - 293390 370004 33973928 67128 5683869
... - 300614 380012 34892019 69635 5896328
... - 307922 390006 35809279 72055 6103210
... - 315294 400002 36730552 74428 6307751
... - 322574 410004 37649683 76881 6518361
... - 329666 420004 38567440 79511 6744984
-: kept aside 334268 of 426360 from first pass
second pass: looking at sequences kept aside in ./tmp4la9vo82khmer/-.pass2
... x 2 426361 ./tmp4la9vo82khmer/-.pass2 334268 426361 39145935 81071 6877505
... x 2 426362 ./tmp4la9vo82khmer/-.pass2 334268 426362 39146036 81072 6877606
... x 2 426363 ./tmp4la9vo82khmer/-.pass2 334268 426363 39146100 81073 6877707
... x 2 426364 ./tmp4la9vo82khmer/-.pass2 334268 426364 39146164 81074 6877771
... x 2 426365 ./tmp4la9vo82khmer/-.pass2 334268 426365 39146231 81075 6877835
... x 2 426366 ./tmp4la9vo82khmer/-.pass2 334268 426366 39146298 81076 6877902
... x 2 426367 ./tmp4la9vo82khmer/-.pass2 334268 426367 39146399 81077 6877969
... x 2 426368 ./tmp4la9vo82khmer/-.pass2 334268 426368 39146499 81078 6878070
... x 2 426369 ./tmp4la9vo82khmer/-.pass2 334268 426369 39146600 81079 6878109
... x 2 426370 ./tmp4la9vo82khmer/-.pass2 334268 426370 39146701 81080 6878210
... x 2 426371 ./tmp4la9vo82khmer/-.pass2 334268 426371 39146793 81081 6878311
... x 2 426372 ./tmp4la9vo82khmer/-.pass2 334268 426372 39146885 81082 6878403
... x 2 426373 ./tmp4la9vo82khmer/-.pass2 334268 426373 39146985 81083 6878495
... x 2 426374 ./tmp4la9vo82khmer/-.pass2 334268 426374 39147086 81084 6878595
... x 2 426375 ./tmp4la9vo82khmer/-.pass2 334268 426375 39147167 81085 6878696
... x 2 426376 ./tmp4la9vo82khmer/-.pass2 334268 426376 39147248 81086 6878777
... x 2 426377 ./tmp4la9vo82khmer/-.pass2 334268 426377 39147322 81087 6878858
... x 2 426378 ./tmp4la9vo82khmer/-.pass2 334268 426378 39147396 81088 6878932
... x 2 426379 ./tmp4la9vo82khmer/-.pass2 334268 426379 39147497 81089 6879006
... x 2 426380 ./tmp4la9vo82khmer/-.pass2 334268 426380 39147596 81090 6879107
... x 2 426381 ./tmp4la9vo82khmer/-.pass2 334268 426381 39147681 81091 6879206
... x 2 426382 ./tmp4la9vo82khmer/-.pass2 334268 426382 39147767 81092 6879291
... x 2 426383 ./tmp4la9vo82khmer/-.pass2 334268 426383 39147868 81093 6879377
... x 2 426384 ./tmp4la9vo82khmer/-.pass2 334268 426384 39147969 81094 6879478
... x 2 426385 ./tmp4la9vo82khmer/-.pass2 334268 426385 39148024 81095 6879579
... x 2 426386 ./tmp4la9vo82khmer/-.pass2 334268 426386 39148079 81096 6879634
... x 2 426387 ./tmp4la9vo82khmer/-.pass2 334268 426387 39148180 81097 6879689
... x 2 426388 ./tmp4la9vo82khmer/-.pass2 334268 426388 39148281 81098 6879790
... x 2 426389 ./tmp4la9vo82khmer/-.pass2 334268 426389 39148382 81099 6879891
... x 2 426390 ./tmp4la9vo82khmer/-.pass2 334268 426390 39148481 81100 6879992
... x 2 426391 ./tmp4la9vo82khmer/-.pass2 334268 426391 39148564 81101 6880091
... x 2 426392 ./tmp4la9vo82khmer/-.pass2 334268 426392 39148649 81102 6880174
... x 2 426393 ./tmp4la9vo82khmer/-.pass2 334268 426393 39148728 81103 6880259
... x 2 426394 ./tmp4la9vo82khmer/-.pass2 334268 426394 39148802 81104 6880338
... x 2 426395 ./tmp4la9vo82khmer/-.pass2 334268 426395 39148903 81105 6880412
... x 2 426396 ./tmp4la9vo82khmer/-.pass2 334268 426396 39149003 81106 6880513
... x 2 426397 ./tmp4la9vo82khmer/-.pass2 334268 426397 39149095 81107 6880613
... x 2 426398 ./tmp4la9vo82khmer/-.pass2 334268 426398 39149196 81108 6880705
... x 2 426399 ./tmp4la9vo82khmer/-.pass2 334268 426399 39149249 81109 6880759
... x 2 426400 ./tmp4la9vo82khmer/-.pass2 334268 426400 39149302 81110 6880812
... x 2 426401 ./tmp4la9vo82khmer/-.pass2 334268 426401 39149395 81111 6880865
... x 2 426402 ./tmp4la9vo82khmer/-.pass2 334268 426402 39149486 81112 6880958
... x 2 430001 ./tmp4la9vo82khmer/-.pass2 334268 430001 39481938 84627 7198818
... x 2 440001 ./tmp4la9vo82khmer/-.pass2 334268 440001 40400998 94418 8083052
... x 2 450001 ./tmp4la9vo82khmer/-.pass2 334268 450001 41318697 104198 8965442
... x 2 460001 ./tmp4la9vo82khmer/-.pass2 334268 460001 42235616 113997 9848363
... x 2 470001 ./tmp4la9vo82khmer/-.pass2 334268 470001 43151050 123802 10731755
... x 2 480001 ./tmp4la9vo82khmer/-.pass2 334268 480001 44072039 133625 11624052
... x 2 490001 ./tmp4la9vo82khmer/-.pass2 334268 490001 44988917 143445 12512680
... x 2 500001 ./tmp4la9vo82khmer/-.pass2 334268 500001 45908432 153295 13405129
... x 2 510001 ./tmp4la9vo82khmer/-.pass2 334268 510001 46827915 163126 14297789
... x 2 520001 ./tmp4la9vo82khmer/-.pass2 334268 520001 47745074 172962 15187803
... x 2 530001 ./tmp4la9vo82khmer/-.pass2 334268 530001 48662515 182813 16079775
... x 2 540001 ./tmp4la9vo82khmer/-.pass2 334268 540001 49581997 192677 16975525
... x 2 550001 ./tmp4la9vo82khmer/-.pass2 334268 550001 50501531 202539 17871891
... x 2 560001 ./tmp4la9vo82khmer/-.pass2 334268 560001 51419773 212416 18768620
... x 2 570001 ./tmp4la9vo82khmer/-.pass2 334268 570001 52334462 222284 19660621
... x 2 580001 ./tmp4la9vo82khmer/-.pass2 334268 580001 53253914 232147 20557706
... x 2 590001 ./tmp4la9vo82khmer/-.pass2 334268 590001 54171283 242018 21453634
... x 2 600001 ./tmp4la9vo82khmer/-.pass2 334268 600001 55089971 251889 22349592
... x 2 610001 ./tmp4la9vo82khmer/-.pass2 334268 610001 56007255 261766 23246847
... x 2 620001 ./tmp4la9vo82khmer/-.pass2 334268 620001 56926686 271650 24146633
... x 2 630001 ./tmp4la9vo82khmer/-.pass2 334268 630001 57843352 281537 25044331
... x 2 640001 ./tmp4la9vo82khmer/-.pass2 334268 640001 58760716 291408 25941536
... x 2 650001 ./tmp4la9vo82khmer/-.pass2 334268 650001 59680891 301304 26843096
... x 2 660001 ./tmp4la9vo82khmer/-.pass2 334268 660001 60597548 311201 27742901
... x 2 670001 ./tmp4la9vo82khmer/-.pass2 334268 670001 61516068 321103 28645788
... x 2 680001 ./tmp4la9vo82khmer/-.pass2 334268 680001 62430643 331009 29544434
... x 2 690001 ./tmp4la9vo82khmer/-.pass2 334268 690001 63348758 340896 30445088
... x 2 700001 ./tmp4la9vo82khmer/-.pass2 334268 700001 64265578 350801 31346353
... x 2 710001 ./tmp4la9vo82khmer/-.pass2 334268 710001 65189866 360708 32254620
... x 2 720001 ./tmp4la9vo82khmer/-.pass2 334268 720001 66109016 370622 33158504
... x 2 730001 ./tmp4la9vo82khmer/-.pass2 334268 730001 67028017 380550 34064695
... x 2 740001 ./tmp4la9vo82khmer/-.pass2 334268 740001 67946583 390475 34970273
... x 2 750001 ./tmp4la9vo82khmer/-.pass2 334268 750001 68865443 400403 35875853
... x 2 760001 ./tmp4la9vo82khmer/-.pass2 334268 760001 69780220 410335 36779205
removing ./tmp4la9vo82khmer/-.pass2
removing temp directory & contents (./tmp4la9vo82khmer)
read 426360 reads, 39145834 bp
wrote 410959 reads, 36833970 bp
looked at 334268 reads twice (1.78 passes)
removed 15401 reads and trimmed 48066 reads (14.89%)
trimmed or removed 5.91%% of bases (2311864 total)
426360 reads were high coverage (100.00%);
skipped 0 reads/0 bases because of low coverage
fp rate estimated to be 0.000
output in outputs.tutorial/abundtrim/HSMA33MX.abundtrim.fq.gz
Write-protecting output file outputs.tutorial/abundtrim/HSMA33MX.abundtrim.fq.gz.
[Thu Feb  4 19:29:16 2021]
Finished job 7.
5 of 15 steps (33%) done

[Thu Feb  4 19:29:16 2021]
rule wc_sourmash_abundtrim:
    input: outputs.tutorial/abundtrim/HSMA33MX.abundtrim.fq.gz
    output: outputs.tutorial/sigs/HSMA33MX.abundtrim.sig
    jobid: 6
    wildcards: sample=HSMA33MX

Activating conda environment: /FmhnLf/.snakemake/conda/09af8546

== This is sourmash version 4.0.0a3. ==
== Please cite Brown and Irber (2016), doi:10.21105/joss.00027. ==

computing signatures for files: outputs.tutorial/abundtrim/HSMA33MX.abundtrim.fq.gz
Computing a total of 1 signature(s).
... reading sequences from outputs.tutorial/abundtrim/HSMA33MX.abundtrim.fq.gz
... outputs.tutorial/abundtrim/HSMA33MX.abundtrim.fq.gz 410959 sequences
calculated 1 signature for 410959 sequences taken from 1 files
saved signature(s) to outputs.tutorial/sigs/HSMA33MX.abundtrim.sig. Note: signature license is CC0.
[Thu Feb  4 19:29:24 2021]
Finished job 6.
6 of 15 steps (40%) done

[Thu Feb  4 19:29:24 2021]
rule wc_prefetch_gather:
    input: outputs.tutorial/sigs/HSMA33MX.abundtrim.sig
    output: outputs.tutorial/genbank/HSMA33MX.x.genbank.prefetch.sig
    jobid: 11
    wildcards: sample=HSMA33MX
    resources: mem_mb=100000000

Activating conda environment: /FmhnLf/.snakemake/conda/09af8546
usage: prefetch_gather.py [-h] [--db DB [DB ...]]
                          [--query [QUERY [QUERY ...]]] --save-matches
                          SAVE_MATCHES [--output-unassigned OUTPUT_UNASSIGNED]
                          [--threshold-bp THRESHOLD_BP] [-k KSIZE]
                          [--moltype MOLTYPE]
prefetch_gather.py: error: argument --db: expected at least one argument
[Thu Feb  4 19:29:24 2021]
Error in rule wc_prefetch_gather:
    jobid: 11
    output: outputs.tutorial/genbank/HSMA33MX.x.genbank.prefetch.sig
    conda-env: /FmhnLf/.snakemake/conda/09af8546
    shell:
        
        python -m genome_grist.prefetch_gather --query outputs.tutorial/sigs/HSMA33MX.abundtrim.sig           --db  --save-matches outputs.tutorial/genbank/HSMA33MX.x.genbank.prefetch.sig -k 31           --threshold-bp=100000.0 --moltype DNA
    
        (one of the commands exited with non-zero exit code; note that snakemake uses bash strict mode!)

Shutting down, this might take some time.
Exiting because a job execution failed. Look above for error message
Complete log: /FmhnLf/.snakemake/log/2021-02-04T192341.335319.snakemake.log
sample: ['HSMA33MX']
outdir: outputs.tutorial
Error in snakemake invocation: Command '['snakemake', '-s', '/root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/Snakefile', '-j', '1', '--use-conda', 'summarize', '--configfile', '/root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/defaults.conf', '/root/miniconda3/lib/python3.8/site-packages/genome_grist/conf/system.conf', '/var/lib/cwl/stgf21b6736-5c26-44f9-8da8-23631b652a00/conf-tutorial.yml']' returned non-zero exit status 1.
INFO [job summarize] Max memory used: 1613MiB
ERROR [job summarize] Job error:
```
Editor is loading...