Untitled

mail@pastecode.io avatar
unknown
plain_text
3 years ago
127 kB
3
Indexable
Never
<?xml version="1.0" encoding="UTF-8" standalone="no"?><beast beautitemplate='Standard' beautistatus='' namespace="beast.core:beast.evolution.alignment:beast.evolution.tree.coalescent:beast.core.util:beast.evolution.nuc:beast.evolution.operators:beast.evolution.sitemodel:beast.evolution.substitutionmodel:beast.evolution.likelihood" required="" version="2.6">


    <data
id="alignedSegment1"
spec="Alignment"
name="alignment">
                        <sequence id="seq_A/Brevig_Mission/1/1918" spec="Sequence" taxon="A/Brevig_Mission/1/1918" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnnnatggaaagaataaaagaactaagggatctaatgtcgcagtctcgcactcgcgagatactcacaaaaaccaccgtggaccatatggccataatcaagaagtacacatcaggaagacaggagaagaaccccgcacttaggatgaaatggatgatggcaatgaaatatccaattacagcagacaagaggataatggaaatgattcctgagagaaatgagcaaggacaaactctatggagtaaaacgaacgatgccggatcagaccgagtgatggtatcacctctggctgtgacatggtggaataggaatggaccaacgacaagtgcagttcactatccaaaaatctacaaaacttattttgaaaaagtcgaaaggttaaaacatggaacctttggccctgtccatttcagaaaccaagtcaaaatacgtcgaagagttgacataaatcctggtcatgcagatctcagtgccaaagaggcacaggatgtaatcatggaagttgttttcccaaacgaagtgggagccaggatactaacatcggaatcgcaactgacaataaccaaagaaaagaaagaagaactccaagattgtaaaatttctcctttaatggtggcatacatgttggagagagaactggtccgaaaaacaagattcctcccagtggctggtgggacaagcagtgtgtatattgaagtgttgcatttgactcaaggaacatgctgggaacagatgtacactccaggaggggaagtgaggaatgatgatgttgatcaaagcttaattattgctgctaggaacatagtgagaagagcgacagtgtcagcagatccactagcatctctgttggaaatgtgccacagcacacagattggtggaataaggatggtagacatccttaggcagaacccgacagaagagcaagccgtggatatatgcaaggcagcaatgggcctgagaattagctcatcctttagctttggcggattcacatttaagaggacaagtggctcatcagtcaagagggaggaagaagtgcttacaggcaatcttcaaacattgaagataagagtgcatgagggatatgaagagttcacaatggttgggagaagagcaacagctatactcagaaaagcgaccaggagattgattcagctgatagtgagtgggagagacgaacagtcgattgccgaggcaataattgtggccatggtattttcacaagaggattgtatgataaaggcagttaggggtgatctgaatttcgttaatagggcgaatcagcgattgaatcctatgcatcaacttttgaggcattttcaaaaggatgcgaaagtgctttttcaaaattggggaattgaacccatcgacaatgtgatgggaatgattgggatactgcccgacatgactccaagtactgagatgtcaatgagaggagtgagagtcagcaaaatgggagtagatgagtactccagcacagagagggtggtggtgagcattgaccgctttttaagagtccgggaccaacgaggaaacgtactactgtctcctgaggaggtcagcgaaacacagggaacagagaaattgacgataacttattcatcgtcaatgatgtgggaggttaatggccctgaatcagtgttggtcaacacctatcagtggatcatcagaaactgggaaactgttaaaattcagtggtcacagaatcctacaatgctatacaataaaatggaatttgagccatttcagtctttagttcctaaggccgctagaggtcaatacagtgggtttgtgagaactctgttccagcaaatgagggatgtgcttgggacatttgacaccgttcagataataaaacttcttccctttgcagccgctccaccaaagcaaagtagaatgcagttctcctctctgactgtgaatgtgagaggatcaggaatgagaatacttgtaaggggcaattctcccgtattcaactacaacaaggccactaagagactcacagttctcggaaaggatgcaggtgctttaactgaagacccagatgaaggcacagctggagtggagtctgctgttctgagaggattcctcattctgggcaaagaagacaggagatatgggccagcattaagcatcaatgaactgagcaatcttgcgaaaggggagaaggctaatgtgctaattgggcaaggagacgtggtgttggtaatgaaacggaaacgggactctagcatacttactgacagccagacagcgaccaaaagaattcggatggccatcaattagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/Hickox/1940" spec="Sequence" taxon="A/Hickox/1940" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnttcaatatggaaagaataaaagaactaaggaatctgatgtcgcagtctcgcactcgcgagatactcacaaaaaccacagtggaccatatggccataattaagaagtacacatcaggaagacaggagaagaacccgtcacttaggatgaaatggatgatggcaatgaaatatccgattacagcagacaagaggataacggaaatgattcctgagagaaatgagcaagggcaaactctgtggagtaaaatgaatgatgccggatcagaccgagtgatggtatcacctctggctgtgacatggtggaatagaaatggaccaatgacaagtacggttcattatccaaaaatctacaaaacttattttgaaaaagtcgaaaggttaaaacatggaacctttggccctgtccattttagaaaccaagtcaaaatacgccgaagagttgacataaatcctggtcatgcagacctcagtgccaaggaggcacaggatgtaatcatggaagttgttttccctaacgaagtgggagccagaatactaacgtcggaatcgcaattaacgataaccaaagaaaagaaagaagaactccaggattgcaaaatttctcctttgatggttgcatacatgttagagagagaacttgtccgcaaaacgagatttctcccagttgctggtggaacaagcagtgtgtacattgaagtgttgcatttgactcaaggaacatgctgggaacagatgtacactccaggtggagaagtgaggaatgatgatgttgatcaaagcctaattattgctgccaggaacatagtgagaagagctgcagtatcagcagatccactagcatctttattggagatgtgccatagcacacagattggtgggacaaagatggtggacattcttaggcagaacccaacagaagagcaagctgtggatatatgcaaggctgcaatgggactgagaatcagctcatccttcagttttggcggattcacatttaagagaacaagcggatcatcagtcaagagagaggaagaagtacttacgggcaatcttcaaacattgaagataagggtgcatgatggatatgaagagttcacaatggttgggaaaagggcaacagctatactcagaaaagcaaccaggagattgattcagctgatagtgagtggaagagacgaacagtcgatagccgaagcaataattgtggccatggtattttcacaagaagattgtatgataaaagcagttagaggtgatctgaatttcgttaatagggcaaatcagcggctgaatcctatgcatcaacttttaagacattttcagaaggatgcgaaagtgctttttcaaaattggggaattgagcatatcgacagtgtgatgggaatgattgggatattaccagacatgactccaagcacagagatgtcaatgagaggagtgagagtcagcaaaatgggcgtagatgaatactccagcgcggagagggtagtggtgagcattgaccgttttttgagagttcgggaccaacgaggaaatgtactactgtctcccgaggaggtcagtgaaacacagggaacggagaaactgacaataacttactcatcgtcaatgatgtgggagattaatggccctgaatcagtgttggtcaatacctatcagtggatcatcagaaactgggaaactgttaaaattcagtggtctcagaatcctacaatgctatacaataaaatggaatttgagccatttcagtctttagttcctaaggccattagaggccaatacagtgggtttgttagaactctgttccaacaaatgagagatgtgcttgggacatttgacaccacccaaataataaaacttcttccctttgcagccgctccaccaaagcaaagtagaatgcagttctcctcattgactgtgaatgtgaggggatcaggaatgagaatacttgtaaggggcaattctccagtattcaactacaacaagaccactaagagactcacaattctcggaaaggatgctggcactttaactgaagacccagatgaaggcacagctggagtggagtccgctgttctgaggggattcctcattctgggcaaagaagataggagatatggaccagcattaagcatcaatgaactgagcaaccttgcgaaaggagaaaaggctaatgtgctaattgggcaaggggacgtggtgttggtaatgaaacgaaaacgggactctagcatacttactgacagccagacagcgaccaaaagaattcggatggccatcaattagtgtcgaatagtttaannnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/WSN/1933" spec="Sequence" taxon="A/WSN/1933" totalcount="4" value="agcgaaagcaggtcaattatattcaatatggaaagaataaaagaactaaggaatctaatgtcgcagtctcgcactcgcgagatactcacaaaaaccaccgtggaccatatggccataatcaagaagtacacatcaggaagacaggagaagaacccagcacttaggatgaaatggatgatggcaatgaaatatccaattacagcagacaagaggataacggaaatgattcctgagagaaatgagcagggacaaactttatggagtaaaatgaatgacgccggatcagaccgagtgatggtatcacctctggctgtgacatggtggaataggaatggaccagtgacaagtacagttcattatccaaaaatctacaaaacttattttgaaaaagtcgaaaggttaaaacatggaacctttggccctgtccattttagaaaccaagtcaaaatacgtcgaagagttgacataaatcctggtcatgcagatctcagtgccaaagaggcacaggatgtaatcatggaagttgttttccctaacgaagtgggagccaggatactaacatcggaatcgcaactaacgacaaccaaagagaagaaagaagaactccagggttgcaaaatttctcctctgatggtggcatacatgttggagagagaactggtccgcaaaacgagattcctcccagtggctggtggaacaagcagtgtgtacattgaagtgttgcatttgacccaaggaacatgctgggaacagatgtacactccaggaggggaggcgaggaatgatgatgttgatcaaagcttaattattgctgctagaaacatagtaagaagagccacagtatcagcagatccactagcatctttattggagatgtgccacagcacgcagattggtggaataaggatggtaaacatccttaggcagaacccaacagaagagcaagccgtggatatttgcaaggctgcaatgggactgagaattagctcatccttcagttttggtggattcacatttaagagaacaagcggatcatcagtcaagagagaggaagaggtgcttacgggcaatcttcagacattgaagataagagtgcatgagggatatgaagagttcacaatggttgggagaagagcaacagctatactcagaaaagcaaccaggagattgattcagctgatagtgagtgggagagacgaacagtcgattgccgaagcaataattgtggccatggtattttcacaagaggattgtatgataaaagcagttagaggtgacctgaatttcgtcaatagggcgaatcagcgattgaatcccatgcaccaacttttgagacattttcagaaggatgcaaaggtgctctttcaaaattggggaattgaatccatcgacaatgtgatgggaatgatcgggatattgcccgacatgactccaagcaccgagatgtcaatgagaggagtgagaatcagcaaaatgggggtagatgagtattccagcgcggagaagatagtggtgagcattgaccgttttttgagagttagggaccaacgtgggaatgtactactgtctcccgaggagatcagtgaaacacagggaacagagaaactgacaataacttactcatcgtcaatgatgtgggagattaatggtcctgaatcagtgttggtcaatacctatcagtggatcatcagaaactgggaaactgttaaaattcagtggtcccagaatcctacaatgctgtacaataaaatggaatttgagccatttcagtctttagttccaaaggccgttagaggccaatacagtgggtttgtgagaactctgttccaacaaatgagggatgtgcttgggacatttgataccgctcagataataaaacttcttcccttcgcagccgctccaccaaagcaaagtagaacgcagttctcctcattgactataaatgtgaggggatcaggaatgagaatacttgtaaggggcaattctccagtattcaactacaacaagaccactaaaagactcacagttctcggaaaggatgctggccctttaactgaagacccagatgaaggcacagctggagttgagtccgcagttctgagaggattcctcattctgggcaaagaagacaggagatatggaccagcattaagcataaatgaactgagcaaccttgcgaaaggagagaaggctaatgtgctaattgggcaaggagacgtggtgttggtaatgaaacggaaacggaactctagcatacttactgacagccagacagcgaccaaaagaattcggatggccatcaattagtgtcgaatagtttaaaaacgaccttgtttctact"/>
                        <sequence id="seq_A/Wilson-Smith/1933" spec="Sequence" taxon="A/Wilson-Smith/1933" totalcount="4" value="nnnnnnnnnnnntcaattatattcaatatggaaagaataaaagaactaaggaatctaatgtcgcagtctcgcactcgcgagatactcacaaaaaccaccgtggaccatatggccataatcaagaagtacacatcaggaagacaggagaagaacccagcacttaggatgaaatggatgatggcaatgaaatatccaattacagcagacaagaggataacggaaatgattcctgagagaaatgagcaaggacaaactttatggagtaaaatgaatgacgccggatcagaccgagtgatggtatcacctctggctgtgacatggtggaatagaaatggaccagtgacaagtacagttcattatccaaaaatctacaaaacttattttgaaaaagtcgaaaggttaaaacatggaacctttggccctgtccattttagaaaccaagtcaaaatacgtcgaagagttgacataaatcctggtcatgcagatctcagtgccaaagaggcacaggatgtaatcatggaagttgttttccctaacgaagtgggagcccggatactaacatcggaatcgcaactaacgataaccaaagagaagaaagaagaactccagggttgcaaaatttctcctttgatggtggcatacatgttggagagagaactggtccgcaaaacgagattcctcccagtggctggtggaacaagcagtgtgtacattgaagtgttgcatttgactcaaggaacatgctgggaacagatgtacactccaggaggggaggtgaggaatgatgatgttgatcaaagcttaattattgctgctaggaacatagtaagaagagccacagtatcagcagatccactagcatctttattggagatgtgccacagcacgcagattggtggaataaggatggtagacatccttaggcagaacccaacagaagagcaagccgtggatatatgcaaggctgcaatgggactgagaattagctcatccttcagttttggtggattcacatttaagagaacaagcggatcatcagtcaagagagaggaagaggtgcttacgggcaatcttcagacattgaagataagagtgcatgagggatatgaagagttcacaatggttgggagaagagcaacagctatactcagaaaagcaaccaggagattgattcagctgatagtgagtgggagagacgaacagtcgattgccgaagcaataattgtggccatggtattttcacaagaggattgtataataaaagcagttagaggtgacctgaatttcgtcaatagggcgaatcagcgattgaatcccatgcaccaacttttgagacattttcagaaggatgcaaaagtgctctttcaaaattggggaattgaatccatcgacaatgtgatgggaatgattgggatattgcccgacatgactccaagcaccgagatgtcaatgagaggagtgagagtcagcaaaatgggggtagatgagtattccagcgcggagaaggtagtggtgagcattgaccgttttttgagagtcagggaccaacgtgggaatgtactactgtctcccgaggaggtcagtgaaacacagggaacagagaaactgacaataacttactcatcgtcaatgatgtgggagattaatggtcctgaatcagtgttggtcaatacctatcagtggatcatcagaaactgggaaactgttaaaattcagtggtcccagaatcctgcaatgctgtacaataaaatggaatttgagccatttcagtctttagttccaaaggccgttagaggccaatacagtgggtttgtgagaactctgttccaacaaatgagggatgtgcttgggacatttgataccgctcagataataaaacttcttcccttcgcagccgctccaccaaagcaaagtagaatgcagttctcctcattgactgtgaatgtgaggggatcaggaatgagaatacttgtaaggggcaattctccagtattcaactacaacaagaccactaaaagactcacagttctcggaaaggatgctggcactttaactgaagacccagatgaaggcacagctggagtggagtccgcagttctgagaggattcctcattctgggcaaagaagacaggagatatggaccagcattaagcataaatgaactgagcaaccttgcgaaaggagagaaggctaatgtgctaattgggcaaggagacgtggtgttggtaatgaaacggaaacggaactctagcatacttactgacagccagacagcgaccaaaagaattcggatggccatcaattagtgtcgaatagtttaaaaannnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/Ohio/23/1935" spec="Sequence" taxon="A/swine/Ohio/23/1935" totalcount="4" value="nnnnnnnnnnnntcaaatatattcaatatggagagaataaaagaactaagggatctaatgtcacagtctcgcactcgcgagatactcacaaggaccaccgtggaccatatggccataatcaagaaatacacatcaggaagacaagagaaaaaccccgcacttagaatgaaatggatgatggcaatgaaatatccaattacagcagacaagaggataattgagacaattcctgagagaaatgaacaaggacaaaccctatggagtaaaacgagcgatgccggatcagaccgagtgatggtatcacctctggctgtgacatggtggaataggaatggaccaacgacaagtacagttcactatccaaaagtctacaaaacttactttgagaaagtcgaaaggttaaaacatggaacttttggccctgttcatttcagaaaccaagtcaaaatacgtcgaagggttgacataaatccaggtcatgcagatctcagtgccaaagaagcacaagatgttatcatggaagttgttttcccaaacgaagtgggagccagaatattgacatcggaatcgcagctaatgattactaaagaaaagaaagaagaactccaggagtgcaaaatttctcctttaatggtggcatacatgttggagagagaactggttcgcaaaacaagattcctcccagtggctggtgggacaagcagtgtgtacattgaggtgttgcatttgactcagggaacatgctgggaacagctatacactccagggggggaagtgaggaacgatgatgttgaccaaagcttaattattgctgctaggagcatagtgagaagagcgacagtatctgcagatccactggcatctctgttggaaatgtgccacagcacacagattggtggaataaggatggtggacatcctcaggcagaacccgacagaagagcaggccgtggatatatgcaaggcagcaatgggtctgagaattagctcatcctttagctttggcgggttcacgttcaaaagaacaagtggctcatcagtcaagaaagaggaggaagtacttacgggcaatctccaaacattgaagataagagtgcatgagggatatgaagaattcacaatggttgggagaagggcaacagctatactcagaaaagcgactaggagattggttcagctaatagtgagtgggagagacgaacagtcgattgccgaggcaataatcgtggccatggtgttttcacaagaggattgtatgataaaggcagttaggggtgatctgaatttcgttaatagggtgaaccagcgattgaaccctatgcaccaacttttaagacattttcaaaaggatgcaaaagtgctttttcaaaattggggaattgaacccatagacaatgtaatgggaatgattgggatactgcccgacttaactccaagcactgagatgtcaatgaggggagtgagaatcagtaagatgggagtagatgagtactccagcacagagagggtggtggtgagcattgaccgttttttaagagtccgagaccaacgagggaacgtgctattgtctcctgaggaggtcagcgaaacacagggaacagagaagttgacgataacttattcatcgtcaatgatgtgggaggttaatggccctgaatcagtgttggtaaacacctaccagtggatcatcagaaactgggaaactgttaaaattcagtggtcacaggatcctacaatgctgtacaataaaatggaatttgaaccattccaatctttggttcctaaggctgcaagaggtcaatacagtgggtttgtgagaactctattccagcaaatgagggatgtgcttggaacatttgacactgttcagataataaaacttctcccctttgcagctgctccaccaaagcagagtagaatgcagttttcttctctgaccgtgaatgtaagaggatcaggaatgagaatacttgtaaggggcaattctcctgtgttcaactacaacaaggccactaagagactcacagttctcggaaaggatgcaggtgctttaactgaagacccagatgaagggacaactggagtggagtctgctgttttgagaggattcctcattctgggcaaagaagacaggagatatgggccagcattaagcatcaatgaactgagaaatcttgcaaaaggggagaaggctaatgtactaattggacaaggagacgtggtgttggtaatgaaacggaaacgggactctagcatacttactgacagccagacagcgaccaaaagaattcgaatggccatcaattagtgtcaaatagtttannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/USA/1976/1931" spec="Sequence" taxon="A/swine/USA/1976/1931" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnnnatggaaagaataaaagaactaagggatctaatgtcacagtctcgcactcgcgagatactcacaaggaccaccgtggaccatatggccataatcaagaagtacacatcaggaagacaggagaaaaaccccgcacttagaatgaaatggatgatggcaatgaaatatccaattacagcagacaagaggataattgagacaattcctgagagaaatgagcaaggacaaactctatggagtaaaacgagcgatgccggatcagaccgagtgatggtatcacctctggctgtgacatggtggaataggaatggaccaacgacaagtacagttcactatccaaaaatctacaaaacttattttgagaaagccgaaaggttaaaacatggaacttttggccctgtccatttcagaaaccaagtcaaaatacgtcgaagagttgacataaatccaggtcatgcagatctcagtgccaaagaagcacaagatgttatcatggaagttgttttcccaaacgaagtgggagcccgaatactaacatcggaatcgcaactaatggtaactaaagaaaagaaagaagaactccaggattgcaaaatttctcctttaatggttgcatacatgttggagagagaactggtccgtaaaacaagattcctcccagtggctggtgggacgagcagtgtgtacattgaagtgttgcatttgactcaagggacatgctgggaacagctatacactccaggaggggaagtgaggaacgatgatgttgatcaaagcttaattattgctgctagaagcatagtaagaagagcgacagtatctgcagatccactggcatctctgttggaaatgtgccacagcacacagattggtggaataaggatggtggacatccttaggcagaacccgacagaagagcaggccgtggatatatgcaaggcagcaatgggtctgagaattagctcatcctttagctttggcgggttcacatttaagagaacaagtggctcatcagtcaagaaggaggaggaagtacttactggcaatctccaaacattgaagataagagtgcatgagggatatgaagaattcacaatggttgggagaagagcaacagctatactcagaaaagcgactaggagattggttcagctaatagtgagtgggagagacgaacagtcgattgccgaagcaataatcgtggcaatggtgttttcacaagaggattgtatgataaaggcagttaggggtgatctgaatttcgttaatagggcgaaccagcgattgaaccctatgcaccaacttttgaggcattttcaaaaggatgcaaaagtgctttttcaaaattggggaattgaacccatagacaatgtgatgggaatgattgggatactgcccgacttgactccaagtactgagatgtcaatgaggggagtgagaatcagcaagatgggagtagatgagtactccagcacagagagggtggtggtgagcattgaccgctttttaagagtccaagaccaacgtgggaacgtactattgtctcctgaggaggtcagcgaaacacagggaacagagaagttgacgataacttattcatcgtcaatgatgtgggaggttaatggccctgaatcagtgttggtcaacacctatcagtggatcatcagaaactgggaaactgttaaaattcagtggtcacaggatcctacaatgctatacaataaaatggaatttgaaccatttcaatctttggttcctaaggctgcaagaggtcaatacagtgggtttgtgagaactctattccagcaaatgagggatgtgcttggaacatttgacactgttcagataataaaacttctcccctttgcagctgctccaccaaagcagaatagaatgcagttttcttctctggctgtgaatgtaagaggatcaggaatgagaatacttgtaaggggcaattctcctgtgttcaactacaacagggccactaagagactcacagttctcggaaaggatgcaggtgctttaactgaagacccagatgaaggcacaactggagtggagtctgctgttctgagaggattcctcattctgggcaaagaagacaggagatatgggccagcattaagcatcaatgaactgagcaatcttgcaaaaggggagaaggctaatgtactaattgggcagggagacgtagtgttggtaatgaaacggaaacgggactctagcatacttaccgacagccagacagcgaccaaaagaattcggatggccatcaattagtgtcaaatagttnnnnnnnnnnnnnnnnnnnnnn"/>
                    </data>
<data
id="alignedSegment4"
spec="Alignment"
name="alignment">
                        <sequence id="seq_A/Brevig_Mission/1/19183" spec="Sequence" taxon="A/Brevig_Mission/1/1918" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatggaggcaagactactggtcttgttatgtgcatttgcagctacaaatgcagacacaatatgtataggctaccatgcgaataactcaaccgacactgttgacacagtactcgaaaagaatgtgaccgtgacacactctgttaacctgctcgaagacagccacaacggaaaactatgtaaattaaaaggaatagccccattacaattggggaaatgtaatatcgccggatggctcttgggaaacccggaatgcgatttactgctcacagcgagctcatggtcctatattgtagaaacatcgaactcagagaatggaacatgttacccaggagatttcatcgactatgaagaactgagggagcaattgagctcagtgtcatcgttcgaaaaattcgaaatatttcccaagacaagctcgtggcccaatcatgaaacaaccaaaggtgtaacggcagcatgctcctatgcgggagcaagcagtttttacagaaatttgctgtggctgacaaagaagggaagctcatacccaaagcttagcaagtcctatgtgaacaataaagggaaagaagtccttgtactatggggtgttcatcatccgcctaccggtactgatcaacagagtctctatcagaatgcagatgcttatgtctctgtagggtcatcaaaatataacaggagattcaccccggaaatagcagcgagacccaaagtaagagatcaagctgggaggatgaactattactggacattactagaacccggagacacaataacatttgaggcaactggaaatctaatagcaccatggtatgctttcgcactgaatagaggttctggatccggtatcatcacttcagacgcaccagtgcatgattgtaacacgaagtgtcaaacaccccatggtgctataaacagcagtctccctttccagaatatacatccagtcacaataggagagtgcccaaaatacgtcaggagtaccaaattgaggatggctacaggactaagaaacattccatctattcaatccaggggtctatttggagccattgccggttttattgaggggggatggactggaatgatagatggatggtatggttatcatcatcagaatgaacagggatcaggctatgcagcggatcaaaaaagcacacaaaatgccattgacgggattacaaacaaggtgaattctgttatcgagaaaatgaacacccaattnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/Hickox/19403" spec="Sequence" taxon="A/Hickox/1940" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnaacaaccaaaatgaaagcaaaactactgatcctgttatgtgcactttcagccacagatgcagacacaatatgtataggctaccatgcgaacaactcaaccgacactgttgacacagtactcgaaaagaatgtgacagtgacacactctgtaaacctactcgaagacagccacaacgggaaattatgcagattaaaaggaatagccccactacaattggggaaatgtaacattgccggatggatcttaggaaacccagaatgcgaatcactgctttctaagagatcatggtcctacattgcagaaacaccaaactctgagaatggaacatgttacccaggagatttcgccgactatgaggaactgagggagcaattgagctcagtatcatcattcgagagattcgaaatattccccaaggaaagatcatggcccaaccacaacataaacataggagtaacggcagcatgctcccatgcggggaaaagcagtttttacaaaaatttgctctggctgacggagaaagatggctcatacccaaatctgaacaagtcctatgtgaacaagaaagagaaagaagtccttgtactatggggtgttcatcacccgtctaacatagagaatcaaaagaccctctatcggaaagaaaatgcttatgtctctgtagtgtcttcaaattataacaggagattcaccccggaaatagcagaaagacccaaagtaagaggtcaagcagggagaatgaactattactggactttgctagaacccggagacacaataatatttgaggcaaatggaaatctaatagcgccatggtatgctttcgcactaagtagaggccttggatcaggaatcatcacctcaaacgcatcaatggatgaatgtgacacgaagtgtcaaacaccccagggagctataaacagtagtctccctttccagaatatacacccattcacaataggagagtgcccaaaatacgtcaggagtaccaaattgaggatggttacaggactaaggaacatcccatccattcaatccagaggtctgtttggagccattgccggtttcattgaagggggatgggctggaatgatagatggatggtatggttaccatcatcagaatgaacagggatctggctatgctgcggatcaaaaaagcacacaaaatgccattaacgggattacaaataaggtaaactctgttatcgagaaaatgaacactcaattcactgctgtgggtaaagaattcaacaaattagaaaaaagaatggaaaacttaaataaaaaagttgatgatggatttctggacatttggacatataatgcagaattgttggttctactggaaaacgaaaggactttggatttccatgactcaaatgtgaagaatctgtatgagaaagtaaaaaaccaattaaggaataatgccaaagaaataggaaacgggtgttttgagttctaccacaagtgtaacaatgaatgcatggaaagtgtaaaaaatggaacttatgattacccaaaatattcagaggaatcaaagttaaacagggaaaaaattgatggagtgaaattggaatcaatgggggtctatcagattctggcgatctactcaactgtcgccagttcactggtgcttctggtctccctgggggcaatcagcttctggatgtgttctaatgggtctttgcagtgcagaatatgcatctgagaccaggatttcaaaaatataannnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/WSN/19333" spec="Sequence" taxon="A/WSN/1933" totalcount="4" value="agcaaaagcaggggaaaataaaaacaaccaaaatgaaggcaaaactactggtcctgttatatgcatttgtagctacagatgcagacacaatatgtataggctaccatgcgaacaactcaaccgacactgttgacacaatactcgagaagaatgtggcagtgacacattctgttaacctgctcgaagacagccacaacgggaaactatgtaaattaaaaggaatagccccactacaattggggaaatgtaacatcaccggatggctcttgggaaatccagaatgcgactcactgcttccagcgagatcatggtcctacattgtagaaacaccaaactctgagaatggagcatgttatccaggagatctcatcgactatgaggaactgagggagcaattgagctcagtatcatcattagaaagattcgaaatatttcccaaggaaagttcatggcccaaccnnnacacattcaacggagtaacagtatcatgctcccataggggaaaaagcagtttttacagaaatttgctatggctgacgaagaagggggattcatacccaaagctgaccaattcctatgtgaacaataaagggaaagaagtccttgtactatggggtgttcatcacccgtctagcagtgatgagcaacagagtctctatagtaatggaaatgcttatgtctctgtagcgtcttcaaattataacaggagattcaccccggaaatagctgcaaggcccaaagtaagagatcaacatgggaggatgaactattactggaccttgctagaacccggagacacaataatatttgaggcaactggtaatctaatagcaccatggtatgctttcgcactgagtagagggtttgagtccggcatcatcacctcaaacgcgtcaatgcatgagtgtaacacgaagtgtcaaacaccccagggagctataaacagcaatctccctttccagaatatacacccagtcacaataggagagtgcccaaaatatgtcaggagtaccaaattgaggatggttacaggactaagaaacatcccatccattcaatacagaggtctatttggagccattgctggttttattgaggggggatggactggaatgatagatggatggtatggttatcatcatcagaatgaacagggatcaggctatgcagcggatcaaaaaagcacacaaaatgccattaacgggattacaaacaaggtgaactctgttatcgagaaaatgaacactcaattcacagctgtgggtaaagaattcaacaacttagaaaaaaggatggaaaatttaaataaaaaagttgatgatgggtttctggacatttggacatataatgcagaattgttagttctactggaaaatgaaaggactttggatttccatgacttaaatgtgaagaatctgtacgagaaagtaaaaagccaattaaagaataatgccaaagaaatcggaaatgggtgttttgagttctaccacaagtgtgacaatgaatgcatggaaagtgtaagaaatgggacttatgattatccaaaatattcagaagaatcaaagttgaacagggaaaagatagatggagtgaaattggaatcaatgggggtgtatcagattctggcgatctactcaactgtcgccagttcactggtgcttttggtctccctgggggcaatcagtttctggatgtgttctaatgggtctttgcagtgcagaatatgcatctgagattaggatttcagaaatataaggaaaaacacccttgtttctact"/>
                        <sequence id="seq_A/Wilson-Smith/19333" spec="Sequence" taxon="A/Wilson-Smith/1933" totalcount="4" value="nnnnnnnnnnnnngaaaataaaaacaaccaaaatgaaggcaagactactggtcctgttatgtgcacttgcagctacagatgcagacacaatatgtataggctaccatgcgaacaactcaaccgacactgttgacacactactcgagaagaatgtgacagtgacacattctgttaacctgctcgaagacagccacaacgggaaactatgtaaattaaaaggaatagccccactacaattggggaaatgtaacatcgccggatggctcttgggaaacccagaatgcgactcactgcttccagcgagatcatggtcctacattgtagaaacaccaaactctgagaatggagcatgttatccaggagatttcatcgactatgaggaactgaaggagcaattgagctcagtatcatcattagaaagattcgaaatatttcccaaggaaagttcatggcccaaccacaacacactcaaaggagtaacagcatcatgctcccatgggggaaaaagcagtttttacagaaatttgctatggctgacgaaaamgggggaytcatacccaaagctgaacaattcctatgtgaacaataaagggaaagaagtccttgtactatggggtgttcatcacccgtctagcagtaatgagcaacagagtctctatcataatgtaaatgcttatgtctctgtagtgtcttcaaattataacaggagattcaccccggaaatagctgcaagacccaaagtaagagatcaacctgggaggatgaactattactggaccttgctagaacccggagacacaataatatttgaggcaactggtaatctaatagcaccatggtatgctttcgcactgagtagaggatttgggtccggcatcatcacctcaaacgcgtcaatgcatgagtgtaacacgaagtgtcaaacaccccagggagctataaacagcagtctccctttccagaatatacacccagtcacaataggagagtgcccaaaatatgtcaggagtaccaaattgaggatggttacaggactaagaaacatcccatccattcaatccagaggtctatttggagccattgctggttttattgaggggggatggactggaatgatagatggatggtatggttatcatcatcagaatgaacagggatcaggctatgcagcggatcaaaaaagcacacaaaatgccattaacgggattacaaacaaggtgaactctgttatcgagaaaatgaacactcaattcacagctgtgggtaaagaattcaacaacttagaaaaaaggatggaaaatttaaataaaaaagttgatgatggatttctggacatttggacatataatgcagaattgttagttctactggaaaatgaaaggactttggatttccatgacttaaatgtgaagaatctgtacgagaaagtaaaaagccaattaaagaataatgccaaagaaatcggaaatgggtgttttgagttctaccacaagtgtgacaatgaatgcatggaaagtgtaagaaatgggacttatgattatccaaaatattcagaagaatcaaagttgaacagggaaaagatagatggagtgaaattggaatcaatgggggtgtatcagattctggcgatctactcaactgtcgccagttcactggtgcttttggtctccctgggggcaatcagtttctggatgtgttctaatgggtctttgcagtgcagaatatgcatctgagattaggatttcagaaatataaggaaaaannnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/Ohio/23/19353" spec="Sequence" taxon="A/swine/Ohio/23/1935" totalcount="4" value="nnnnnnnnnnnnngaaaataaaagcaaccgaaatgaaggcaagactattagtcttgttatgtgcacttgcagctacaaatgcagacacactatgtataggttaccatgcaaataactcaaccgacactgttgacacagtactcgagaagaatgtaaccgtgacacactctgttaaccttcttgaagacagccacaacggaaaactatgtagactagggggaatagccccattacaactgggtaaatgtaatattgccggatggctcttgggaaacccagaatgcgatttgctgctcacagtgagctcatggtcctatattgtggaaacatcaaactccgataatgggacatgttacccaggagatttcatagactatgaagaactgagagagcaattgagctcagtgtcatcattcgaaagattcgagatatttcccaagacaagctcgtggcccaatcatgaaacaaccakcggtgtaacggcagcatgcccctatgctggagcaaacagcttttacagaaatttactatggctggtgaagaagggagattcatacccaaagcttagcaaatcctatgttaacaataaagggaaagaagtccttgtgctatggggtgttcatcatccgcctaccagtactgawcaacaaagtctctatcaaaatgcagatgcttatgtttctgtagggtcatcaaaatataacaggaggttcaccccagaaatagcagcgagacccaaagtgagaggtcaggcagggaggatgaactattactggacattactagaacccggagacacaataacatttgaggcaactggaaatctagtggcaccaagatatgctttcgcactgaataaaggttctggatccggtgtcatcacttcagacgcaccagtgcatgattgtgacacgaagtgtcaaacaccccatggtgctataaacagcagtctccctttccagaatatacatccagtcacaataggagagtgcccaaaatacgtcaagagtactaaattaaggatggctacaggactgagaaacatcccatctatccaatctagaggtctgtttggagctattgccggttttattgaagggggatggactggaatgatagatggatggtatggttaccatcagcagaatggacaaggatcaggctatgcagcggaccaaaagagcacacaaaatgccattgacgggatcacaaacaaggtgaattctgttatcgagaagatgaacacgcaattcacagcagtgggtaaagaattcaacaacctagaaagaaggatagaaaatttaaataaaaaggtcgatgatggatttctggatgtttggacatataatgccgaactgttagttctattggaaaatgaaaggactctggattttcatgactcgaatgtaaagaatttgtatgagaaagtaagaagccaactaagaaataatgccaaagaaatcgggaatggatgctttgaattctaccacaaatgtgataatgcatgcatggagagcgtcagaaatgggacttatgactacccaaagtattcagaagaatcaaaattgaacagagaagaaatagatggagtaaagttggaatcaatgagggtctatcagattctggcgatctattcaaccgtcgccagttcactagtgctgtcagtctccctgggggcaatcagcttctggatgtgttctaatgggtctttacagtgcaggatatgcatttaaaattagaatttcagagacataaggnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/USA/1976/19313" spec="Sequence" taxon="A/swine/USA/1976/1931" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatgaaggcaagactattagtcttgttatgtgcatttgcagctacaaatgcagacacactatgtataggttaccatgcaaataactcaaccgacacagttgacacagtactcgagaagaatgtaaccgtgacacactctgttaacctgcttgaagacagccacaatggaaaactatgtagactgggaggaatagccccattacaactggggaaatgtaatattgccggatggctcttgggaaacccagaatgcgatttgctgctcacagtgagctcatggtcctatattgtagaaacatcggactcagataatgggacatgttacccaggagatttcatcgactatgaagaactgagagagcaactgaactcaatgtcatcattcgaaaaattcgagatatttcccaagacaagctcgtggcccaatcatgaaacaaccaaaggtgtaacggcagcatgcccctatgctggagcaagcagcttttacagaaacttactatggctggtaaagaaggaaaattcatacccaaagcttagcaaatcctatgttaacaataaaggaaaagaagtccttgtgctatggggtgttcatcatccgcctaccagtactgatcaacaaagtctctatcaaaatgcagatgcttatgtttctgtagggtcatcaaaatattacaggaggttcactccagaaatagcagcgagacccaaagtgagaggtcaggcagggaggatgaactattactggacattactagaacccggagacacaataacatttgaggcaactggaaatttagtggcaccaagatatgctttcgcactgaatagaggttctggatccggtatcatcacttcaaacgcaccagtgcatgattgtgacacgaagtgtcaaacacctcatggtgccataaacagcagtctccctttccagaatgtacatccagtcacaataggagagtgcccaaaatacgtcaagagtaccaaattaaggatggttacaggactaagaaacatcccatctatccagtctagaggtctgtttggagccattgccggttttattgaggggggatggactggattgatagatggatggtatggttaccatcatcagaatggacagggatcaggctatgcagcggaccaaaagagcacacaaaatgccattgacgggattactaacaaggtgaattctgttatcgagaagatgaacacgcaattcacagcagtgggtaaagaattcaacaacctagaaagaaggatagaaaatttaaataaaaaagtcgatgatggatttctggatatttggacatataatgcagaactgttagttctattggaaaatgagaggactctggatttccatgactcaaatgtaaagaacctgtatgagaaagtaagaagccaactaaggaataatgccaaggaaatcgggaatggatgctttgaattctaccacaaatgtgatgatgcatgcatggaaagcgtcagaaatgggacttatgattacccaaagtattcagaagaatcaaaattgaacagagaagaaatagatggtgtgaaattggaatcaatgatggtctatcagattctggcgatctattcaaccgtcgccagttcactagtactgttagtctccctgggggcaatcagcttctggatgtgttctaatgggtctttgcagtgcagaatatgcatttaaaactagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                    </data>
<data
id="alignedSegment5"
spec="Alignment"
name="alignment">
                        <sequence id="seq_A/Brevig_Mission/1/19184" spec="Sequence" taxon="A/Brevig_Mission/1/1918" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatggcgtctcaaggcaccaaacgatcttacgaacagatggagactgatggggaacgccagaatgccactgaaatcagagcatctgtcggaagaatgattggtggaattggacgattctacatccaaatgtgcaccgaacttaaactcagtgattatgagggacggctgatccagaacagcataacaatagagagaatggtgctctctgcttttgacgagaggaggaataaatatctggaagaacatcccagcgctgggaaagaccctaagaaaactggaggacccatatacaggagaatagatggaaagtggatgagagaactcatcctttatgacaaagaagaaataaggagaatctggcgccaagctaataatggtgaagatgcaacagctggtctgactcacatgatgatctggcattccaatttgaatgatgccacttatcagaggacaagagctcttgttcgcaccggaatggatcccaggatgtgctctctgatgcaaggttcaactctccctaggaggtctggagccgcaggtgctgcagtcaaaggagttggaacaatggtgatggagttgatcaggatgatcaaacgtgggatcaatgatcggaacttctggaggggtgagaatggacgaaggacaagaattgcctatgaaagaatgtgcaacattctcaaagggaaatttcaaacagctgcacagagagcaatgatggatcaagtgagagagagccggaatccaggaaatgctgaaattgaagatctcatctttctggcacggtctgcactcatattgagagggtcagttgctcacaagtcctgcctgcctgcctgtgtgtatggacctgctgtagccagtggatacgactttgaaagagagggatactctctggtcggaatagaccctttcagactgcttcaaaacagccaagtatacagtctaatcagaccaaatgagaatccagcacacaagagtcaactggtatggatggcatgccattctgctgcatttgaagatctgagagtatcaagcttcatcagagggacaagagtggttccaagagggaagctttccactagaggggttcagattgcttccaatgaaaacatggagactatggactccagtacccttgaactgagaagcagatactgggccataaggaccagaagtggaggaaacactaatcaacagagggcatctgcgggccaaatcagcgtgcaacctacattctcagtacagagaaacctcccttttgagagagcaaccattatggcagcattcactgggaacacagaggggagaacatctgacatgagaaccgaaatcataaggatgatggaaagtgcaagaccagaagatgtgtctttccaggggcggggagtcttcgagctctcggacgaaaaggcaacgagcccgatcgtgccttcctttgacatgagtaatgaaggatcttatttcttcggagacaatgcagaggagtacgacaattaannnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/Hickox/19404" spec="Sequence" taxon="A/Hickox/1940" totalcount="4" value="nnnnnnnnnnnnnnnnnnnntcactcactgagtgacatcataatcatggcgtcccaaggcaccaaacggtcttacgaacagatggagactgatggggaacgccagaatgccactgaaatcagagcatccgtcggaaaaatgattagtggaattggacgattctacatccaaatgtgcaccgaacttaaactcagtgattatgagggacggctgatccagaacagcttaacaatagagagaatggtgctctctgcttttgacgagaggaggaataaatatctggaagaacatcccagcgcagggaaagatcctaagaaaactggaggacccatatacaagagagtaggtggaaagtggatgagggaactcatcctttatgacaaagaagaaataaggcgaatctggcgccaagctaataatggtgatgatgcaacggctggtctgactcacatgatgatctggcattccaatttgaatgatacaacttatcagaggacaagagctcttgtccgcaccggaatggatcccaggatgtgctctctgatgcagggttcaactctccctaggaggtctggagccgcaggcgctgcagtcaaaggagttgggacaatggtgatggagttgatcaggatgatcaaacgtgggatcaatgatcgaaacttctggaggggtgagaatggacgaaaaacaaggattgcttatgagagaatgtgcaacattctcaaagggaaatttcaaacagctgcacaaagagcaatgatggatcaagtgagagaaagccggaatccaggaaatgctgagatcgaagatctcatctttctggcacggtctgcactcatattgagagggtcagttgctcacaagtcttgcctgcctgcctgtgtgtatggacctgcagtagccagcggatacgacttcgaaagagagggatactctctagtcggaatagaccctttcaaactgcttcaaaacagccaagtatacagcctaataagaccaaacgagaatccagcacacaagagtcagctggtgtggatggcatgcaattctgctgcatttgaagatctaagagtatcaagcttcatcagagggacaaaggtagtcccaagggggaggctttccactagaggagttcaaattgcttcaaatgaaaacatggatactatggaatcaagtactcttgaactgagaagcaggtactgggccataaggaccagaagtggaggaaacactaatcaacagagggcttctgcaggccaaatcagcatacaacctacgttttctgtacagagaaatctcccatttgacaaaacaaccatcatggcagcattcactgggaatgcagagggaagaacatctgacatgagggcagaaatcataaggatgatggagaatgcaagaccagaagaagtgtccttccaggggcggggtgtcttcgagctctcggacgaaagggcagcgaacccgatcgtgccctcctttgacatgagtaatgaaggatcttatttcttcggagacaatgcagaggagtacgacaattaannnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/WSN/19334" spec="Sequence" taxon="A/WSN/1933" totalcount="4" value="agcaaaagcagggtagataatcactcacagagtgacatcgaaatcatggcgaccaaaggcaccaaacgatcttacgaacagatggagactgatggagaacgccagaatgccactgaaatcagagcatctgtcggaaaaatgattgatggaattggacgattctacatccaaatgtgcaccgaacttaaactcagtgattatgagggacggctgattcagaacagcttaacaatagagagaatggtgctctctgcttttgacgagaggaggaataaatatctagaagaacatcccagtgcggggaaagatcctaagaaaactggaggacctatatacaggagagtagatggaaagtggaggagagaactcatcctttatgacaaagaagaaataagacgaatctggcgccaagctaataatggtgacgatgcaacggctggtctgactcacatgatgatctggcactccaatttgaatgatgcaacttaccagaggacaagagctcttgttcgcacaggaatggatcccaggatgtgctcactgatgcagggttcaaccctccctaggaggtctggggccgcaggtgctgcagtcaaaggagttggaacaatggtgatggaattgatcagaatgatcaaacgtgggatcaatgatcggaacttctggaggggtgagaatggacggagaacaaggattgcttatgaaagaatgtgcaacattctcaaagggaaatttcaaacagctgcacaaagaacaatggtggatcaagtgagagagagccggaatccaggaaatgctgagttcgaagatctcatctttttagcacggtctgcactcatattgagagggtcagttgctcacaagtcctgcctgcctgcctgtgtgtatggatctgccgtagccagtggatacgactttgaaagagagggatactctctagtcggaatagaccctttcagactgcttcaaaacagccaagtatacagcctaatcagaccaaatgagaatccagcacacaagagtcaactggtgtggatggcatgccattctgctgcatttgaagatctaagagtatcaagcttcatcagagggacgaaagtggtcccaagagggaagctttccactagaggagttcaaattgcttccaatgaaaacatggagactatggaatcaagtacccttgaactgagaagcagatactgggccataaggaccagaagtggagggaacaccaatcaacagagggcttcctcgggccaaatcagcatacaacctacgttctcagtacagagaaatctcccttttgacagaccaaccattatggcagcattcactgggaatacagaggggagaacatctgacatgagaaccgaaatcataaggctgatggaaagtgcaagaccagaagatgtgtctttccaggggcggggagtcttcgagctctcggacgaaaaggcaacgagcccgatcgtgccctcctttgacatgagtaatgaaggatcttatttcttcggagacaatgcagaggagtacgacaattaaagaaaaatacccttgtttctact"/>
                        <sequence id="seq_A/Wilson-Smith/19334" spec="Sequence" taxon="A/Wilson-Smith/1933" totalcount="4" value="nnnnnnnnnnnnntagataatcactcacagagtgacatcgaaatcatggcgaccaaaggcaccaaacgatcttacgaacagatggagactgatggagaacgccagaatgccactgaaatcagagcatctgtcggaaaaatgattggtggaattggacgattctacatccaaatgtgcaccgaacttaaactcagtgattatgagggacggctgattcagaacagcttaacaatagagagaatggtgctctctgcttttgacgagaggaggaataaatatctagaagaacatcccagtgcggggaaagatcctaagaaaactggaggacctatatacaggagagtagatggaaagtggatgagagaactcatcctttatgacaaagaagaaataagacgaatctggcgccaagctaataatggtgacgatgcaacggctggtctgactcacatgatgatctggcactccaatttgaatgatgcaacttaccagaggacaagagctcttgttcgcacaggaatggatcccaggatgtgctcactgatgcagggttcaaccctccctaggaggtctggggccgcaggtgctgcagtcaaaggagttggaacaatggtgatggaattgatcagaatgatcaaacgtgggatcaatgatcggaacttctggaggggtgagaatggacggagaacaaggattgcttatgaaagaatgtgcaacattctcaaagggaaatttcaaacagctgcacaaagagcaatggtggatcaagtgagagagagccggaatccaggaaatgctgagttcgaagatctcatctttctagcacggtctgcactcatattgagagggtcagttgctcacaagtcctgcctgcctgcctgtgtgtatggacctgccgtagccagtggatacgactttgaaagagagggatactctctagtcggaatagaccctttcagactgcttcaaaacagccaagtatacagcctaatcagaccaaatgagaatccagcacacaagagtcaactggtgtggatggcatgccattctgctgcatttgaagatctaagagtatcaagcttcatcagagggacgaaagtggtcccaagagggaagctttccactagaggagttcaaattgcttccaatgaaaacatggagactatggaatcaagtacccttgaactgagaagcagatactgggccataaggaccagaagtggagggaacaccaatcaacagagggcttcctcgggccaaatcagcatacaacctacgttctcagtacagagaaatctcccttttgacagaccaaccattatggcagcattcactgggaatacagaggggagaacatctgacatgagaaccgaaatcataaggctgatggaaagtgcaagaccagaagatgtgtctttccaggggcggggagtcttcgagctctcggacgaaaaggcagcgagcccgatcgtgccctcctttgacatgagtaatgaaggatcttatttcttcggagacaatgcagaggagtacgacaattaaagaaaaatnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/Ohio/23/19354" spec="Sequence" taxon="A/swine/Ohio/23/1935" totalcount="4" value="nnnnnnnnnnnnntagataatcactcactgagtgacatcgaaatcatggcgtctcaaggcaccaaacgatcatacgaacaaatggaaactggtggggaacgccagaatgccacggaaatcagggcatctgtaggaagaatgattggtggaattggacgattctacatccaaatgtgcaccgaactcaaactcagtgattatgagggacgactgattcaaaatagcataacaatagagagaatggtgctctctgcttttgacgagaggaggaataaatacctggaagaacatcccagcgctgggaaagaccctaagaaaactggaggacccatatataggaaaatagacggaaagtggatgagagaactcatcctttatgacaaagaagaaataaggagaatctggcgccaagccaacaatggtgaggatgcaacagccggtctgactcacattatgatttggcattccaatttgaatgatgccacttatcagaggacaagagctcttgttcgcaccggaatggaccccaggatgtgctctctgatgcagggttcaactctccccagaaggtctggagccgcaggtgctgcagtcaaaggagttgggacaatggtgatggagttgatcagaatgatcaaacgtggaatcaatgaccggaacttctggaggggtgaaaatggacgaaggacaagaattgcctatgaaagaatgtgcaacatccttaaaggaaaatttcaaacagctgcacagagagcaatgatggatcaagtgagagaaagtcgaaatccaggaaatgctgaaattgaagatctcatctttctggcacggtccgcactcatattaagaggatcagttgcacacaagtcttgtctgcctacctgtgtgtatggacttgctgtagcaagtggacatgactttgaaagagaagggtactctctggtcggaatagaccctttccgactgcttcaaaacagccaaatattcagcctaatcagaccaaatgaaaacccagctcacaagagtcaactggtgtggatggcatgccattctgccgcatttgaagatttaagagtatcaagcttcataagaggaaaaagagtggttccaagagggcagctttccaccagaggagttcagattgcttccaatgagaacatggagactatggactctagtactcttgaattgagaagcagatactgggccataaggaccagaagtggaggaaacactaatcaacagagagcatccgcgggccagatcagcgtgcaacctacattctcggtgcaaagaaatctcccttttgagagagcaaccgttatggcagcattcattgggaacacagagggaagaacatcagacatgagaaccgaaatcataaggatgatggaaagtgcaaaaccagaagatgtgtctttccaggggcggggagtcttcgagctctcggacgaaaaggcaacgagcccgatcgtgccttcctttgacatgagtaacgaaggatcttatttcttcggagacaatgcagaggagtatgacaattaaagannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/USA/1976/19314" spec="Sequence" taxon="A/swine/USA/1976/1931" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatggcgtctcaaggcaccaaacgatcatatgaacaaatggaaactggtggagaacgccagaataccacggaaatcagagcatctgtcggaagaatgattggtggaattggaagattctacatccaaatgtgcaccgaactcaaactcgatgattatgagggacggctgattcagaacagcataacaatagagagaatggtgctctctgcttttgacgagaggaggaacaaatatctggaagaacatccaagcgctgggaaagaccctaagaaaactggagggcccctatacaggagaatagacggaaagtggataagagaactcatcctttatgacaaagaagaaataaggagaatctggcgccaagccaacaatggtgaggatgcaacagccggtctgactcacatgatgatctggcattccaatttgaatgatgccacttatcagaggacaagagctcttgttcgcaccggaatggatcccaggatgtgctctctgatgcagggttcaactctccccaggaggtctggagccgcaggtgctgcagtcaaaggagttgggacaatggtgatggagctgatcagaatgatcaaacgtggaatcaatgatcggaacttctggaggggtgaaaatggacgaaggacaagaattgcctatgaaagaatgtgcaacattctcaaaggaaaatttcaaacagctgcacagagagcaatgatggatcaagtgagagagagccgaaacccaggaaatgctgaaatcgaagatctcatctttctggcacggtccgcactcatattacgaggatcagttgcacacaagtcctgtctgcctgcctgtgtgtatggacttgctgtagccagtggacatgactttgaaagagaggggtactctctggtcggaatagaccctttcagactgcttcaaaacagccaagtattcagcctaatcagaccaaatgaaaacccagcgcacaagagtcaactagtgtggatggcatgccattctgctgcatttgaagatttaagggtatcaagcttcataagagggaaaagagtggttccaagagggcaactttccaccagaggggttcagattgcttccaatgagaacatggagactatggactctagtactcttgaactgagaagcagatactgggccataaggaccagaagtggaggaaacactaatcaacagagggcatctgcgggccaaatcagcgtgcaacctacattctcggtgcagagaaatctcccttttgagagagcaaccgttatggcagcattcactgggaacacagagggaagaacatcagacatgagaaccgaaatcataaggataatggaaagtgcaagaccagaagatgtgtctttccaggggcggggagtcttcgagctctcggacgaaaaggcaacgagcccgatcgtgccttcctttgacatgagtaacgaaggatcttatttcttcggagacagtgcagaggagtatgacaattaaagannnnnnnnnnnnnnnnnnnn"/>
                    </data>
<data
id="alignedSegment7"
spec="Alignment"
name="alignment">
                        <sequence id="seq_A/Brevig_Mission/1/19186" spec="Sequence" taxon="A/Brevig_Mission/1/1918" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnatgagtcttttaaccgaggtcgaaacgtacgttctctctatcgtcccgtcaggccccctcaaagccgagatcgcgcagagacttgaagatgtctttgcagggaagaacaccgatcttgaggctctcatggaatggctaaagacaagaccaatcctgtcacctctgactaaggggattttaggatttgtgttcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtccaaaatgcccttaatgggaacggggatccaaataacatggacagagcagttaaactgtacaggaagcttaagagggagataacattccatggggccaaagaagtagcactcagttattccgctggtgcacttgccagttgtatgggcctcatatacaacaggatggggactgtgaccactgaagtggcatttggcctggtatgcgcaacctgtgaacagattgctgattcccagcatcggtctcacaggcaaatggtgacaacaaccaatccactaatcagacatgagaacagaatggtactggccagcactacggctaaggctatggagcaaatggctggatcgagtgagcaagcagcagaggccatggaggttgctagtcaggctaggcaaatggtgcaggcgatgagaaccattgggactcatcctagctccagtgctggtctgaaagacgatcttattgaaaatttgcaggcctaccagaaacgaatgggggtgcagatgcaacgattcaagtgatcctctcgttattgccgcaagtatcattgggatcttgcacttgatattgtggattcttgatcgtctttttttcaaatgcatttatcgtcgccttaaatacggtttgaaaagagggccttctacggaaggagtgccggagtctatgagggaagaatatcgaaaggaacagcagagtgctgtggatgttgacgatggtcattttgtcaacatagagctggagtaannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/Hickox/19406" spec="Sequence" taxon="A/Hickox/1940" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnngatgagtcttctaaccgaggtcgaaacgtacgttctctctatcgtcccgtcaggccccctcaaagccgagatcgcacagagacttgaagatgtatttgctgggaagaacaccgaccttgaggctctcatggaatggctaaagacaagaccaatcctgtcacctctgactaaggggattttagggtttgtgttcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtccaaaatgcccttaatgggaatggagatccaaataacatggacagagcagttaaactgtataggaagcttaagagggagataacattccatggggccaaagaaatagcactcagttattctgctggtgcacttgccagttgtatgggccttatatacaacaggatgggggctgtgaccactgaagtggcatttggcctggtatgcgcaacctgtgaacagattgccgactcccagcatcggtctcataggcaaatggtgacaacaaccaatccactaataagacatgagaacagaatggttctagccagcactacagctaaggctatggagcaaatggctggatcgagtgagcaagcagcagaggccatggaggttgctagtcaggctaggcaaatggtgcaggcgatgagagccattggaactcatcctagctccagtgctggtctgaaaaatgatcttcttgaaaatttgcaggcctatcagaaacgaatgggagtgcagatgcaacgattcaagtgatcctctcgttgttgccgcaagtatcattgggatcttgcacttgatattgtggattcttgatcgtctttttttcaaatgcatttatcgtctctttaaacacggtctaaaaagagggccttctacggaaggagtgccaaagtctatgagggaagaatatcgaaaggaacagcagagtgctgtggatgctgacgatagtcattttgtcaacatagagctggagtaannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/WSN/19336" spec="Sequence" taxon="A/WSN/1933" totalcount="4" value="agcaaaagcaggtagatattgaaagatgagtcttctaaccgaggtcgaaacgtacgttctctctatcgtcccgtcaggccccctcaaagccgagatcgcacagagacttgaagatgtctttgcagggaagaacaccgatcttgaggttctcatggaatggctaaagacaagaccaatcctgtcacctctgactaaggggattttaggatttgtgttcacgctcaccgtgcccagtgagcggggactgcagcgtagacgctttgtccaaaatgctcttaatgggaacggagatccaaataacatggacaaagcagttaaactgtataggaagcttaagagggagataacattccatggggccaaagaaatagcactcagttattctgctggtgcacttgccagttgtatgggcctcatatacaacaggatgggggctgtgaccactgaagtggcatttggcctggtatgcgcaacctgtgaacagattgctgactcccagcatcggtctcataggcaaatggtgacaacaaccaatccactaatcagacatgagaacagaatggttctagccagcactacagctaaggctatggagcaaatggctggatcgagtgagcaagcagcagaggccatggatattgctagtcaggccaggcaaatggtgcaggcgatgagaaccgttgggactcatcctagctccagtgctggtctaaaagatgatcttcttgaaaatttgcaggcctatcagaaacgaatgggggtgcagatgcaacgattcaagtgatcctctcgtcattgcagcaaatatcattggaatcttgcacttgatattgtggattcttgatcgtctttttttcaaatgcatttatcgtcgctttaaatacggtttgaaaagagggccttctacggaaggagtgccagagtctatgagggaagaatatcgaaaggaacagcagaatgctgtggatgttgacgatggtcattttgtcaacatagagctggagtaaaaaactaccttgtttctact"/>
                        <sequence id="seq_A/Wilson-Smith/19336" spec="Sequence" taxon="A/Wilson-Smith/1933" totalcount="4" value="nnnnnnnnnnngtagatattgaaagatgagtcttctaaccgaggtcgaaacgtacgttctctctatcgtcccgtcaggccccctcaaagccgagatcgcacagagacttgaagatgtctttgcagggaagaacaccgatcttgaggctctcatggaatggctaaagacaagaccaatcctgtcacctctgactaaggggattttaggatttgtgttcacgctcaccgtgcccagtgagcggggactgcagcgtagacgctttgtccaaaatgctcttaatgggaacggagatccaaataacatggacaaagcagttaaactgtataggaagcttaagagggagataacattccatggggccaaagaaatagcactcagttattctgctggtgcacttgccagttgtatgggcctcatatacaacaggatgggggctgtgaccactgaagtggcatttggcctggtatgcgcaacctgtgaacagattgctgactcccagcatcggtctcataggcaaatggtgacaacaaccaatccactaatcagacatgagaacagaatggttctagccagcactacagctaaggctatggagcaaatggctggatcgagtgagcaagcagcagaggccatggatattgctagtcaggccaggcaaatggtgcaggcgatgagaaccattgggactcatcctagctccagtgctggtctaaaagatgatcttcttgaaaatttgcaggcctatcagaaacgaatgggggtgcagatgcaacgattcaagtgatcctctcgttattgcagcaaatatcattgggatcttgcacttgatattgtggattcttgatcgtctttttttcaaatgcatttatcgtcgctttaaatacggtttgaaaagagggccttctacggaaggagtgccagagtctatgagggaagaatatcgaaaggaacagcagaatgctgtggatgttgacgatggtcattttgtcaacatagagctggagtaaaaaannnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/Ohio/23/19356" spec="Sequence" taxon="A/swine/Ohio/23/1935" totalcount="4" value="nnnnnnnnnnnntagatgtttaaagatgagccttctaaccgaggtcgaaacgtacgttctctctatcgtcccatcaggccccctcaaagccgagatcgcacagagacttgaagatgtttttgcagggaagaacaccgatcttgaggctctcatggaatggctaaagacaagaccaatcctgtcacctctgactaagggaattttaggatttgtgttcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtccaaaatgcccttaacgggaacggtgacccaaataacatggacaaagcagttaaactgtacaggaaacttaagagggagataacattccacggggccaaagaagtagcgctcagttattctgctggtgcacttgccagttgtatgggcctcatatacaacagaatggggactgttaccactgaagtggcatttggcctagtatgcgcaacctgcgaacagattgctgattcccagcatcggtctcacagacaaatggtgacaacaaccaatccactaatcagacatgagaacagaatggtactagccagcaccacggctaaagctatggagcaaatggctggatcgagtgagcaagcggcagaggccatggaggttgctagccaggctaggcaaatggtacaggcgatgagaacaattgggactcaccctagctccagtgctggtctgaaagatgatcttcttgaaaatttgcaggcctaccagaaacgaatgggggtgcagatgcaacgattcaagtgaccctctcgttgctgccgcaagcatcattggaatcttgcacttgatattgtggattcttgatcgtctttttttcaaatgcatttatcgtcgccttgaatacggtttgaaaagagggccttctacggaaggagtgccggagtctatgagggaagaatatcggcagaaacagcagagtgctgtggatgttgacgatggtcattttgtcaacatagagctggagtaannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/USA/1976/19316" spec="Sequence" taxon="A/swine/USA/1976/1931" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnatgagccttctaaccgaggtcgaaacgtacgttctctctatcgtcccatcaggccccctcaaagccgagatcgcgcagagacttgaagatgtttttgcagggaaaaacaccgatcttgaggctctcatggaatggctaaagacaagaccaatcctgtcacctctgactaagggaattttaggatttgtgttcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtccaaaatgcccttaacgggaacggtgacccaaataacatggacaaagcagttaaactgtacaggaaacttaagagggagataacattccacggggccaaagaagtagcgctcagttattctgctggtgcacttgccagttgtatgggcctcatatacaacagaatggggactgttaccactgaagtggcatttggcctagtatgcgcaacctgcgaacagattgctgattcccagcatcggtctcacaggcaaatggtgacaacaaccaatccattaatcagacatgagaacagaatggtactagccagcactacggctaaagctatggagcaaatggctggatcgagtgagcaagcagcagaggccatggaggttgctagccaggctaggcaaatgatacaggcgatgagaacaattgggacccaccctagctccagtgctggtctgaaagatgatcttcttgaaaatttgcaggcctaccagaaacgaatgggggtgcagatgcaacgattcaagtgaccctctcgttgctgccgcaagcatcattgggatcttgcacttgatattgtggattcttgatcgtctttttttcaaatgcatttatcgtcgccttaaatacggtttgaaaagagggccttctacggaaggagtgccggagtccatgagggaagaatatcggcagaaacagcagagtgctgtggatgttgacgatggtcattttgtcaacatagagctggagtaannnnnnnnnnnnnnnnnnnn"/>
                    </data>
<data
id="alignedSegment3"
spec="Alignment"
name="alignment">
                        <sequence id="seq_A/Brevig_Mission/1/19182" spec="Sequence" taxon="A/Brevig_Mission/1/1918" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnatggaagactttgtgcgacaatgcttcaatccgatgattgtcgagcttgcggaaaaagcaatgaaagagtatggagaggacctgaaaatcgaaacaaacaaatttgcagcaatatgcactcacttggaagtatgcttcatgtattcagattttcacttcatcaatgagcgaggcgaatcaataatcgtagaatctggcgatccaaatgcactcttgaagcacagatttgaaataatcgagggaagagatcgcacaatggcctggacggtggtaaacagtatttgcaacactacaggggctgagaaaccaaagtttctcccagatctgtatgattacaaggagaatagattcattgagattggagtaacaaggagagaagtccacatatactatctggaaaaggccaataaaataaaatctgagaagacacacatccacattttctcgttcactggggaagaaatggccacaaaggccgactacactctcgatgaggagagcagggctaggatcaaaaccagactattcaccataagacaagagatggccagcagaggcctctgggattcctttcgtcagtccgagagaggcgaagagacaattgaagaaagatttgaaatcacaggaacaatgcgcaggcttgccgaccaaagtctcccaccgaacttctccagccttgaaaactttagagcctatgtggatggattcgaaccgaacggctacattgagggcaagctttctcaaatgtccaaagaagtaaatgctagaattgaaccttttttgaagacaacaccacgcccacttaggctgccagatgggcctccctgttctcagcggtccaaattcctgctgatggatgccttgaaattaagcattgaggacccaagccatgaaggagaggggataccgctatatgatgcgatcaagtgcatgagaacattctttgggtggaaggaacccaatgttgttaagccacacgaaaagggaataaatccaaattatctcttggcatggaagcaagtactggcagaactgcaggatattgagaatgaggagaaaattccaaagactaaaaatatgaagaaaacgagccagttaaagtgggcacttggtgagaatatggcaccagaaaaagtggattttgacgactgtaaagatgtaagcgatctgaagcaatatgatagtgatgaaccggaattgaggtcgcttgcaagttggattcagagtgagttcaacaaggcatgcgaactgaccgattcaagctggatagagctcgatgagattggagaagatgtggctccaattgaacacattgcaagcatgagaaggaattatttcacagcagaggtgtctcattgcagagccacagaatacataatgaagggggtatacatcaatactgccttgcttaatgcatcctgtgcagcaatggatgatttccaattaattccaatgataagcaagtgtagaactaaggagggaagacgaaagaccaatttgtacgggttcatcataaaaggaagatcccacttaaggaatgacaccgacgtggtaaattttgtgagcatggagttttccctcactgatccaagacttgaaccgcacaaatgggagaagtactgtgtccttgagataggggatatgcttctaagaagtgccataggccaagtgtcaaggcccatgttcttgtatgtgaggacaaatgggacatcaaaaattaaaatgaaatggggaatggaaatgagacgttgcctccttcagtcacttcaacaaatcgagagtatgattgaagctgagtcctctgtcaaggagaaagacatgaccaaagaattctttgagaacaaatcagaaacatggcccattggagagtcccccaaaggagtggaggaaggttccattgggaaggtctgcaggactttgttggcaaaatcggtattcaacagcttgtatgcatctccacaactagaaggattctcagctgaatcaagaaaactgcttcttatcgttcaggctcttagggacaacctggaacctggaacctttgatcttggggggctatatgaagcaattgaggagtgcctgattaatgatccctgggttttgcttaatgcgtcttggttcaactccttcctcacacatgcactgagatagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/Hickox/19402" spec="Sequence" taxon="A/Hickox/1940" totalcount="4" value="nnnnnnnnnnnnnnntgatccgaaatggaagattttgtgcgacaatgcttcaatccgatgattgtcgagcttgcggaaaaggcaatgaaagagtatggagaggacccgaaaatcgaaacaaacaaacttgcagcaatatgcactcacttggaagtgtgcttcatgtattcagattttcacttcatcaatgagcaaggcgaatcaataatagtagaacttggtgatccaaacgcacttctgaagcacagatttgaaataatcgagggaagagatcgcacaatggcctggacagtggtaaacagtatttgcaacactacaggggctgagaaaccgaagtttctgccagatttgtatgattacaaggagaatagattcatcgaaattggagtgacaaggagggaagttcacatttactatctggaaaaggccaataaaattaaatctgagaagacacacatccacattttctcgttcactggggaagaaatggccacaaaggccgactacactctcgatgaggaaagcagagctagaatcaaaaccagactattcaccataagacaagaaatggctagcagaggcctttgggattcctttcgtcagtccgagagaggcgaagagacaattgaagaaaaatttgaaatcacaggaacaatgcgcaagctcgccgaccaaagtctcccgccgaacttctcctgccttgagaattttagagcctatgtggatggattcgaaccgaacggctacattgagggcaagctttctcaaatgtccaaagaagtgaatgctagaattgaacctttttttaagacaacaccacgaccaattagacttccggatgggcctccttgttctcagcggtccaaattcctgctgatggatgctttaaaattaagcattgaggacccaagtcatgaaggagagggaataccactatatgatgcgatcaagtgcatgaggacattctttggatggaaagaaccctatgttgttaaaccacacgaaaagggaataaatccaaattatctgctgtcatggaagcaagtactggcagaactgcaggacattgaaaatgaggagaagattccaaagactaaaaacatgaagaaaacgagtcagctaaagtgggcacttggtgagaacatggcaccagaaaaggtagactttgacgactgtaaagatgtaagcgatttgaagcaatattatagtgatgaaccagaattgaggtcactttcaagttggatccagaatgagttcaacaaggcctgcgagctgaccgattcagtctggatagagcttgatgaaattggagaagatgtggctccaattgaacacattgcaagcatgagaaggaattacttcacagcagaggtgtctcattgcagagccacagaatacataatgaagggggtatacattaatactgccttgcttaatgcatcctgtgcagcaatggatgatttccaattaattcccatgataagcaaatgtagaactaaagagggaaggcgaaagaccaatttgtatggtttcatcataaaaggaaggtctcacttaaggaatgacaccgacgtggtaaactttgtgagcatggaattttctctcactgacccaagacttgagccacacaaatgggagaagtactgtgttcttgagataggagatatgcttctaagaagtgccataggccaggtgtcaaggcccatgttcttatatgtgaggacaaatggaacctcaaaaattaaaatgaaatggggaatggagatgaggcgttgcctccttcagtcacttcaacaaattgagagcatgattgaagccgagtcctctgtcaaggagaaagacatgaccaaagagttttttgagaataaatcagaaacatggcccattggagagtcccccaaaggggtggaagaaggttccattgggaaggtatgcaggactttattggcaaagtcggtattcaatagcttgtatgcatctccacaactagaaggattttcagctgaatcaagaaaactgctccttattgttcaggctcttagggacaacctggaacctgggacctttgatcttggggggctatatgaagcagttgaggagtgcctgattaatgatccctgggttttgcttaatgcttcttggttcaactccttcctcacacatgcattaagatagttgtggcaatgctactnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/WSN/19332" spec="Sequence" taxon="A/WSN/1933" totalcount="4" value="agcgaaagcaggtactgattcaaaatggaagattttgtgcgacaatgcttcaatccgatgattgtcgagcttgcggaaaaggcaatgaaagagtatggagaggacctgaaaatcgaaacaaacaaatttgcagcaatatgcactcacttggaagtgtgcttcatgtattcagattttcacttcatcgatgagcaaggcgagtcaatagtcgtagaacttggcgatccaaatgcacttttgaagcacagatttgaaataatcgagggaagagatcgcacaatagcctggacagtaataaacagtatttgcaacactacaggggctgagaaaccaaagtttctaccagatttgtatgattacaagaagaatagattcatcgaaattggagtaacaaggagagaagttcacatatactatctggaaaaggccaataaaattaaatctgagaagacacacatccacattttctcattcactggggaggaaatggccacaaaggccgactacactctcgatgaagaaagcagggctaggatcaaaaccaggctattcaccataagacaagaaatggctagcagaggcctctgggattcctttcgtcagtccgagagaggcgaagagacaattgaagaaagatttgaaatcacaggaacaatgcgcaagcttgccgaccaaagtctcccgccaaacttctccagccttgaaaaatttagagcctatgtggatggattcgaaccgaacggctacattgagggcaagctttctcaaatgtccaaagaagtaaatgctagaattgaaccttttttgaaatcaacaccacgaccacttagacttccggatgggcctccctgttctcagcggtccaaattcctgctgatggatgccttaaaattaagcattgaggacccaagtcatgagggagaggggataccgctatatgatgcaatcaaatgcatgagaacattctttggatggaaggaacccaatgttgttaaaccacacgaaaagggaataaatccaaattatcttctgtcatggaagcaagtactggcagaactgcaggacattgagaatgaggagaaaattccaaggactaaaaatatgaagaaaacgagtcagttaaagtgggcacttggtgagaacatggcaccagaaaaggtagactttgacgattgtaaagatgtaggcgatttgaagcaatatgatagtgatgaaccagaattgaggtcgcttgcaagttggattcagaatgagttcaacaaggcatgtgaactgaccgattcaagctggatagagctcgatgagattggagaagatgcggctccaattgaacacattgcaagcatgagaaggaattatttcacagcagaggtgtctcattgcagagccacagaatacataatgaagggggtgtacatcaatactgccttgcttaatgcatcctgtgcagcaatggatgatttccaattaattccaatgataagcaagtgtagaactaaggagggaaggcgaaagaccaatttgtacggtttcatcataaaaggaagatcccacttaaggaatgacaccgatgtggtaaactttgtgagcatggagttttccctcactgacccaagacttgaaccacacaaatgggagaagtactgtgttcttgaggtaggagatatgcttctaagaagtgccataggccatgtgtcaaggcctatgttcttgtatgtgaggacaaatggaacctcaaaaattaaaatgaaatgggggatggaaatgaggcgttgcctccttcagtcacttcaacaaatcgagagtatgattgaagctgagtcctctgtcaaggagaaagacatgaccaaagagttctttgaaaacaaatcagaaacatggcccgttggagagtcccccaaaggagtggaggaaggttccattgggaaggtctgcagaactttattggcaaagtcggtattcaacagcttgtatgcatctccacaactagaaggattttcagctgaatcaagaaaactgcttcttatcgttcaggctcttagggacaacctggaacctgggacctttgatcttggggggctatatgaagcaattgaggagtgcctgattaatgatccctgggttttgcttaatgcttcttggttcaactccttcctcacacatgcattgagatagttgtggcaatgctactatttgctatccatactgtccaaaaaagtaccttgtttctact"/>
                        <sequence id="seq_A/Wilson-Smith/19332" spec="Sequence" taxon="A/Wilson-Smith/1933" totalcount="4" value="nnnnnnnnnnngtactgattcaaaatggaagattttgtgcgacaatgcttcaatccgatgattgtcgagcttgcggaaaaggcaatgaaagagtatggagaggacctgaaaatcgaaacaaacaaatttgcagcaatatgcactcacttggaagtgtgcttcatgtattcagattttcacttcatcgatgagcaaggcgagtcaataatcgtagaacttggcgatccaaatgcacttttgaagcacagatttgaaataatcgagggaagagatcgcacaatggcctggacagtaataaacagtatttgcaacactacaggggctgagaaaccaaagtttctaccagatttgtatgattacaaggagaatagattcatcgaaattggagtaacaaggagagaagttcacatatactatctggaaaaggccaataaaattaaatctgagaagacacacatccacattttctcattcactggggaggaaatggccacaaaggccgactacactctcgatgaagaaagcagggctaggatcaaaaccaggctattcaccataagacaagaaatggctagcagaggcctctgggattcctttcgtcagtccgagagaggcgaagagacaattgaagaaagatttgaaatcacaggaacaatgcgcaagcttgccgaccaaagtctcccgccgaacttctccagccttgaaaattttagagcctatgtggatggattcgaaccgaacggctacattgagggcaagctttctcaaatgtccaaagaagtaaatgctagaattgaaccttttttgaaatcaacaccacgaccacttagacttccggatgggcctccctgttctcagcggtccaaattcctgctgatggatgccttaaaattaagcattgaggacccaagtcatgagggagaggggataccgctatatgatgcaatcaaatgcatgagaacattctttggatggaaggaacccaatgttgttaaaccacacgaaaagggaataaatccaaattatcttctgtcatggaagcaagtactggcagaactgcaggacattgagaatgaggagaaaattccaaggactaaaaatatgaagaaaacgagtcagttaaagtgggcacttggtgagaacatggcaccagaaaaggtagactttgacgactgtaaagatgtaggcgatttgaagcaatatgatagtgatgaaccagaattgaggtcgcttgcaagttggattcagaatgagttcaacaaggcatgtgaactgaccgattcaagctggatagagctcgatgagattggagaagatgtggctccaattgaacacattgcaagcatgagaaggaattatttcacagcagaggtgtctcattgcagagccacagaatacataatgaagggggtgtacatcaatactgccttgcttaatgcatcctgtgcagcaatggatgatttccaattaattccaatgataagcaagtgtagaactaaggagggaaggcgaaagaccaatttgtacggtttcatcataaaaggaagatcccacttaaggaatgacaccgacgtggtaaactttgtgagcatggagttttccctcactgacccaagacttgaaccacacaaatgggagaagtactgtgttcttgaggtaggagatatgcttctaagaagtgccataggccatgtgtcaaggcctatgttcttgtatgtgaggacaaatggaacctcaaaaattaaaatgaaatgggggatggaaatgaggcgttgcctccttcagtcacttcaacaaatcgagagtatgattgaagctgagtcctctgtcaaggagaaagacatgaccaaagagttctttgagaacaaatcagaaacatggcccgttggagagtcccccaaaggagtggaggaaggttccattgggaaggtctgcagaactttattggcaaagtcggtattcaacagcttgtatgcatctccacaactagaaggattttcagctgaatcaagaaaactgcttcttatcgttcaggctcttagggacaacctggaacctgggacctttgatcttggggggctatatgaagcaattgaggagtgcctgattaatgatccctgggttttgcttaatgcttcttggttcaactccttcctcacacatgcattgagatagttgtggcaatgctactatttgctatccatactgtccaaaaaannnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/Ohio/23/19352" spec="Sequence" taxon="A/swine/Ohio/23/1935" totalcount="4" value="nnnnnnnnnnnnnnnnnatccaaaatggaagactttgtgcgacaatgcttcaatccgatgattgtcgagcttgcggaaaagacaatgaaagaatatggagaggacccgaaaatcgaaacaaacaaatttgcagcaatatgcactcacatggaagtatgcttcatgtattcagatttccacttcatcaatgaacggggcgaatcaataatcgtagaatctggcgatccaaatgcactcttgaagcacagatttgaaataatcgaaggaagagatcggactatggcctggacggtggtgaacagtatttgtaacattacaggggttgggaaaccaaagtttctcccagatctgtatgactacaaggaagatagattcattgagattggtgtaacaaggagagaagtccatatatactacctggaaaaggccaataaaataaaatctgaagagacacacatccacattttctcattcacgggagaagaaatggccacaaaggccgactacactctcgatgaagaaagtagggctagaataaaaaccaggctattcaccataagacaagagatggctagcagaggcctctgggattcctttcgtcagtccgagagaggcgaagagacaattgaagaaagatttgagatcacaggaacaatgcgcaggcttgctgaccaaagtctcccaccgaacttctccagtcttaaaaactttagagcctatgtggatggattcgagccgaacggctacattgagggcaagctttctcaaatgtccaaagaagtaaatgctagaattgagccttttttgaagacaacaccacgcccacttaggctgccatgtgggcctccctgttttcagcgatccaaattcctgttgatggatgccctgaagttaagcattgaagacccaagccatgaaggagaggggataccgctatatgatgcgatcaagtgcatgaaaacgttctttgggtggaaggaacccattattgttaagccacacgaaaaaggaataaattcaaattaccttttggcatggaagcaagtactggcagagctacaggatatcgaggatgagaaaaaagttccaaggactaagaacatgaagaaaacaagccagttaaagtgggcacttggtgagaatatggcaccagaaaaggtggactttgacgactgtaaggatgtaagcgatctgaagcaatatgatagtgatgaaccagaatttaggtcgcttgcaagttggattcaaagtgagttcaacaaagcatgtgaactgactgattcaagctggatagaactcgatgagattggagaagatgtggctccgattgagcacattgcaagcatgagaaggaattatttcacagcagaggtgtctcattgcagagccacagaatacataatgaagggagtatacatcaatactgctttgcttaatgcatcctgtgcagcaatggatgatttccaattgattccaatgataagcaaatgtagaactaaagagggaagacgaaagaccaatttgtacggattcatcataaaaggaagatcccacttaaggaatgacaccgacgtggtaaattttgtgagcatggagttttccctcactgatccaagacttgaaccgcacaaatgggagaagtactgtatccttgagataggagacatgcttctaagaactgccataggtcaagtgtcaaggcctatgttcctatatgtgaggacaaatgggacctcaaaaattaaaatgaaatggggaatggaaatgagacgttgcctccttcagtccctccagcagattgagagtatgattgaagctgagtcctctgtcaaggagaaagacatgaccaaagaattctttgagaacaaatcagaaacatggcccattggagagtcccccaaaggagtggaagaaggttccattgggaaggtctgtaggacattgttggcaaagtcggttttcaacagtttgtatgcatctccacaattagaaggattctcagctgaatcaagaaaattgcttctcatcgttcaggctcttagggacaatcttgaacctggaacttttgatcttggggggctatatgaatcaattgaggagtgcctgattaatgatccctgggttttgcttaatgcatcttggttcaactccttcctcacacatgcactgagatagttgtggcattgctactatttgctatccatactgtccannnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/USA/1976/19312" spec="Sequence" taxon="A/swine/USA/1976/1931" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnatggaagactttgtgcgacaatgcttcaacccgatgattgtcgagcttgcggaaaaggcaatgaaagagtatggggaggacccgagaatcgaaacaaacaaatttgcagcaatatgcacccacatggaagtatgcttcatgtattcagattttcacttcatcaatgaacggagcgaatcaataatcgtagaatctggcgatccaaatgcactcttgaagcacagatttgaaataatcgaaggaagagatcgaacaatggcctggacggtggtgaacagcatttgtaacactacaggggttgggaaaccaaagtttctcccagatctgtatgactacaaggaagatagattcattgagattggtgtaacaaggagagaagtccacatatactacctggaaaaggccaataaaataaaatctgaagagacacacatccacattttctcattcacgggagaagaaatggccacaaaggccgactacactctcgatgaagaaagtagggctagaatcaaaactaggctattcaccataagacaagagatggctagcagaggcctttgggattcctttcgtcagtccgagagaggcgaagagacaattgaagaaagatttgaaatcacagggacaatgcgcaggcttgccgaccaaagtctcccaccgaatttctccagtcttgaaaactttagggcctatgtggatggattcgagccgaacggctacattgagggcaagctttctcaaatgtccaaagaagtaaatgctagaattgagccttttctgaagacaacaccacgcccacttaagctgccaggtgggcccccctgttctcagcgatccaaattcctgttgatggatgccctgaaattaagcattgaagacccaagccatgaaggagaggggataccgctatatgatgcgatcaagtgcatgaaaacgttctttgggtggaaggaacccattattgttaagccacacgaaaaaggaataaattcaaattaccttttggcatggaagcaagtactggcagaattacaggatattgagaatgagaaaaaagttccaaggactaagaatatgaagaaaacaagccagttaaagtgggcacttggggagaatatggcaccagaaaaagtggattttgacgactgtaaggatgtaagcgatctgaagcaatatgacagtgatgaaccagagtttaggtcgcttgcaagttggattcaaagtgagttcaacaaagcatgtgaactgactgattcaagctggatagaactcgatgagattggagaagatgtggctccgattgagcacattgcaagcatgagaagggattatttcacagcagaggtgtctcattgcagagccacagaatacataatgaagggagtgtacatcaatactgctttgcttaatgcatcctgtgcagcaatggacgatttccaattgattccaatgataagcaagtgtagaactaaagagggaaggcgaaagaccaatttgtacgggttcatcataaaaggaagatcccacttaaggaatgacacagacgtggtaaattttgtgagcatggagttttccctcactgacccaagacttgaaccgcacaaatgggagaagtactgtgtccttgagataggagacatgcttctaagaactgccataggccaagtgtcaaggcctatgttcctgtatgtgaggacaaatgggacctcaaaaattaaaatgaaatggggaatggaaatgagacgttgcctccttcagtcccttcagcagattgagagtatgattgaagctgagtcctctgtcaaggagaaagacatgaccaaagaattctttgagaacaaatcagaaacatggcccattggagagtcccccaaaggagtggaagaaggttccattgggaaggtctgtaggactttgttggcaaagtcggttttcaacagcttgtatgcatctccacaactagaaggattctcagctgaatcaagaaaattgcttcttatcgttcaggctcttagggacaatctggaacctggaacttttgatcttggggggctatatgaatcaattgaggagtgcctgattaatgatccctgggttttgcttaatgcttcttggttcaactccttcctcacacatgcactgagatagttgtggcagtgctactnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                    </data>
<data
id="alignedSegment2"
spec="Alignment"
name="alignment">
                        <sequence id="seq_A/Brevig_Mission/1/19181" spec="Sequence" taxon="A/Brevig_Mission/1/1918" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnatggatgtcaatccgactttacttttcttgaaagtgccagcgcaaaatgctataagcacaacgttcccttatactggagaccctccttacagccatgggacaggaacaggatacaccatggatactgtcaacaggacacatcagtactcagaaaagggaagatggacaacaaacaccgagactggagcaccacaactcaacccgattgatggaccactgccagaagacaatgaaccaagtggttatgcccaaacagattgtgtattggaagcaatggctttccttgaggagtcccaccccggtatctttgaaaactcgtgtcttgaaacgatggaggttgttcagcaaacacgagtggacaagctgacgcaaggccgacagacctatgactggactctaaataggaaccagcctgctgcaacagcattggccaacacaatagaagtgttcagatcaaatggcctcacggccaatgaatctggaaggctcatagacttcctcaaggatgtcatggagtcaatggacaaagaagaaatggaaatcacaactcattttcagagaaagagaagagtgagagacaacatgactaagaaaatggtgacacagagaacaataggtaaaaagaagcagaggttgaacaaaaggagttatctaatcagggcactgaccctgaacacaatgaccaaagatgctgagagagggaagctaaaacggagagcaattgcaaccccagggatgcaaatacgaggatttgtatactttgttgagacactggcaaggagtatatgtgagaaacttgaacaatcaggattgccagttggaggtaatgagaagaaagccaagttggcaaatgttgtaaggaagatgatgaccaattctcaggacactgagctttctttcaccatcactggagataacaccaaatggaacgaaaatcagaatcctcggatgtttttggccatgatcacatacataaccagaaatcagcccgaatggttcagaaatgttctaagtattgctccaataatgttctcaaacaaaatggcgagactggggaaggggtacatgttcgagagcaagagtatgaaacttagaactcaaatacctgcagagatgctagcaagcatcgatttgaaatatttcaatgattcaacaagaaagaaaattgaaaaaatccgaccgctcttaatagatgggactgcatcattgagccctggaatgatgatgggcatgttcaatatgttaagcactgtattaggcgtctccatcctgaatcttggacaaaagagatacaccaagactacttactggtgggatggtcttcaatcttctgatgattttgctctgattgtgaatgcacccaatcatgagggaattcaagccggagtcgacaggttttatcgaacctgtaagctgcttggaatcaatatgagcaagaaaaagtcttacataaacagaacaggcacatttgaattcacaagttttttctatcgctatgggtttgttgccaatttcagcatggagcttcccagctttggggtgtctgggatcaacgagtctgcggacatgagtattggagttactgtcatcaaaaacaatatgataaacaatgatcttggtccagcaacagctcaaatggcccttcagttgttcatcaaagattacaggtacacgtaccggtgccacaggggtgacacccaaatacaaacccgaagatcatttgaaataaagaaattgtgggagcaaacccgttccaaagctggactgctggtctccgacggaggccccaatttgtacaacattagaaatctccacattcctgaagtctgcttgaaatgggaattgatggatgaggattaccaggggcgtttatgcaacccactgaacccatttgtcagccataaagaaattgaatcagtgaataatgcagtgatgatgccagcacatggtccagccaaaaacatggagtatgatgctgttgcaacaacacactcctggattcccaaaagaaatcgatccatcttgaacacaagccagagaggaatacttgaagatgaacaaatgtaccaaaaatgctgcaatttatttgaaaaattcttccccagcagttcatacaggagaccagtcgggatttccagtatggtggaggccatggtttctagggcccgaattgatgcacggattgatttcgaatctggaaggataaagaaagaggagttcgctgagatcatgaagatctgttccaccattgaagagctcagacggcaaaagtagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/Hickox/19401" spec="Sequence" taxon="A/Hickox/1940" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnaatggatgtcaatccgaccttacttttcttaaaagtgccagcacaaaatgctataagcacaacttttccttatactggagaccctccttacagccatggaacaggaacaggatacaccatggatactgtcaacaggacacatcagtactcagaaaggggaaggtggacaacaaacaccgaaactggagcaccacaactcaacccgattgatggaccactgccagaagacaatgaaccaagtggttatgcccaaacagattgtgtattggaagcaatggctttccttgaggaatcccatcctggtatttttgaaaactcgtgtattgagacaatggaggttgttcagcaaacacgagtggacaaactgacacagggccgacagacctatgactggactctaaatagaaaccagcctgctgcaacagcattggccaacacaatagaagtgttcagatcaaatggtctcacggccaatgaatctggaaggctaatagacttccttaaggatgtaatggaatcaatggacaaagaagaaatggagatcacaactcattttcagagaaagagacgagtgagagacaatgtgactaagaaaatggtgacacagagaacaataggtaaaaggaagcagagattgaacaaaagaagttatctaattagagcattgaccctgaacacaatgaccaaagatgctgagagagggaagctaaaacgaagagcaattgcaaccccagggatgcaaataagagggtttgtatattttgttgagacattggcaagaagtatatgtgaaaaacttgaacaatctggattaccagttggaggcaatgagaagaaagcaaagttggcaaatgttgtaaggaagatgatgaccaattctcaggacactgaaatttctttcaccatcactggagataacaccaaatggaacgaaaatcagaaccctaggatgtttttggccatgatcacatatatgaccagaaatcagccagaatggttcagaaatgttctaagtattgctccaataatgttctcaaacaaaatggcgagactaggaaagggatacatgtttgaaagcaagagtatgaaacttagaactcaaatacctgcagaaatgctagcaaacatcgatttgaagtatttcaatgattcaacaagaaagaagattgaaagaatccgaccactcttaatagatgggactgcatcactgagccctggtatgatgatgggcatgttcaatatgttaagcactgtattgggcgtctccatcctgaatcttggacaaaagagatacaccaagactacttactggtgggatggtcttcaatcttctgatgattttgcgctgattgtgaatgcacccaatcatgaaggaattcaagccggagttgacaggttttatcgaacctgtaagttactcggaatcaatatgagcaagaaaaagtcttacataaacagaacaggtacatttgaattcacgagctttttctatcgttatgggtttgttgccaatttcagcatggagcttcccagttttggggtgtctggaatcaacgagtctgcagacatgagtattggagtcactgtcatcaaaaacaatatgataaacaatgatcttggtccagcaacagctcaaatggcccttcagttgttcatcaaagattacaggtacacatatcgatgccatagaggtgacacacaaatacaaacccgaagatcatttgaaataaagaaactgtgggagcaaacccgttccaaagctggtctgctggtctccgacggaggcccaaatttatacaacattagaaatcttcacattcctgaagtctgcttgaaatgggaattgatggatgaagattaccaggggcgtttatgcaacccactgaacccatttgtcagtcataaagagattgaatcagtgaacaatgcagtgatgatgccggcacatggcccagccaaaaacatggaatatgatgctgttgcaacaacacactcctggatccccaaaagaaatcggtccatcttgaatacgagccagagaggaatacttgaagatgaacaaatgtatcaaaggtgctgcaatttgtttgaaaaattcttccccagcagttcatacagaagaccagtcggaatatccagtatggtggaggctatggtttcaagagcccgaattgatgcacggattgacttcgaatcaggaaggataaagaaagaggagttcactgagatcatgaagatctgttccaccattgaagaactcagacggcaaaaatagtgaatttaacttgtccttcatgannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/WSN/19331" spec="Sequence" taxon="A/WSN/1933" totalcount="4" value="agcgaaagcaggcaaaccatttgaatggatgtcaatccgactttacttttcttaaaagtgccagcacaaaatgctataagcacaactttcccttatactggagaccctccttacagccatgggacaggaacaggatacaccatggatactgtcaacaggacacatcagtactcagaaaggggaagatggacaacaaacaccgaaactggagcaccgcaactcaacccgattgatgggccactgccagaagacaatgaaccaagtggttatgcccaaacagattgtgtattggaagcaatggccttccttgaggaatcccatcctggtatctttgagacctcgtgtcttgaaacgatggaggttgttcagcaaacacgagtggacaagctgacacaaggccgacagacctatgactggactctaaataggaaccagcctgctgcaacagcattggccaacacaatagaagtgttcagatcaaatggcctcacggccaatgaatctggaaggctcatagacttccttaaggatgtaatggagtcaatgaacaaagaagaaatggagatcacaactcattttcagagaaagagacgagtgagagacaatatgactaagaaaatggtgacacagagaacaataggtaaaaggaagcagagattgaacaaaaggagttatctaattagggcattaaccctgaacacaatgaccaaagatgctgagagagggaagctaaaacggagagcaattgcaaccccagggatgcaaataagggggtttgtatactttgttgagacactagcaaggagtatatgtgagaaacttgaacaatcaggattgccagttggaggcaatgagaagaaagcaaagttggcaaatgttgtaaggaagatgatgaccaattctcaggacactgaaatttctttcaccatcactggagataacaccaaatggaacgaaaatcagaaccctcggatgtttttggccatgatcacatatataaccagaaatcagcccgaatggttcagaaatgttctaagtattgctccaataatgttctcaaacaaaatggcgagactgggaaaggggtacatgtttgagagcaagagtatgaaaattagaactcaaatacctgcagaaatgctagcaagcatcgatttgaaatacttcaatgattcaactagaaagaagattgaaaaaatccggccgctcttaatagatgggactgcatcattgagccctggaatgatgatgggcatgttcaatatgttaagtactgtattaggcgtctccatcctgaatcttggacaaaagagacacaccaagactacttactggtgggatggtcttcaatcttctgatgattttgctctgattgtgaatgcacccaatcatgaagggattcaagccggagtcaacaggttttatcgaacctgtaagctacttggaattaatatgagcaagaaaaagtcttacataaacagaacaggtacatttgaattcacaagttttttctatcgttatgggtttgttgccaatttcagcatggagcttcccagctttggggtgtctgggatcaacgagtctgcggacatgagtattggagttactgtcatcaaaaacaatatgataaacaatgatcttggtccagcaaccgctcaaatggcccttcagctgttcatcaaagattacaggtacacgtaccggtgccatagaggtgacacacaaatacaaacccgaagatcatttgaaataaagaaactgtgggagcaaacccattccaaagctggactgctggtctccgacggaggcccaaatttatacaacattagaaatctccacattcctgaagtctgcttgaaatgggaattaatggatgaggattaccaggggcgtttatgcaacccactgaacccatttgtcaaccataaagacattgaatcagtgaacaatgcagtgataatgccagcacatggtccagccaaaaacatggagtatgatgctgttgcaacaacacactcctggatccccaaaagaaatcgatccatcttgaatacaagccaaagaggaatacttgaagatgaacaaatgtaccaaaagtgctgcaacttatttgaaaaattcttccccagcagttcatacagaagaccagtcgggatatccagtatggtggaggctatggtttccagagcccgaattgatgcacgaattgatttcgaatctggaaggataaagaaagaggagttcactgagatcatgaagatctgttccaccattgaagagctcagacggcaaaaatagtgaatttagcttgtccttcatgaaaaaatgccttgtttctact"/>
                        <sequence id="seq_A/Wilson-Smith/19331" spec="Sequence" taxon="A/Wilson-Smith/1933" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnaatggatgtcaatccgactttacttttcttaaaagtgccagcacaaaatgctataagcacaactttcccttatactggagaccctccttacagccatgggacaggaacaggatacaccatggatactgtcaacaggacacatcagtactcagaaaggggaagatgggcaacaaacaccgaaactggagcaccgcaactcaacccgattgatgggccactgccagaagacaatgaaccaagtggttatgcccaaacagattgtgtattggaagcaatggccttccttgaggaatcccatcctggtatctttgaaaactcgtgtcttgaaacgatggaggttgttcagcaaacacgagtggacaagctgacacaaggccgacagacctatgactggactctaaataggaaccagcctgctgcaacagcattggccaacacaatagaagtgttcagatcaaatggcctcacggccaatgaatctggaaggctcatagacttccttaaggatgtaatggagtcaatgaacaaagaagaaatggagatcacaactcattttcagagaaagagacgagtgagagacaatatgactaagaaaatggtgacacagagaacaataggtaaaaggaagcagagattgaacaaaaggagttatctaattagggcattaaccctgaacacaatgaccaaagatgctgagagagggaagctaaaacggagagcaattgcaaccccagggatgcaaataagggggtttgtatactttgttgagacactagcaaggagtatatgtgagaaacttgaacaatcaggattgccagttggaggcaatgagaagaaagcaaagttggcaaatgttgtaaggaagatgatgaccaattctcaggacactgaaatttctttcaccatcactggagataacaccaaatggaacgaaaatcagaaccctcggatgtttttggccatgatcacatatataaccagaaatcagcccgaatggttcagaaatgttctaagtattgctccaataatgttctcaaacaaaatggcgagactgggaaaggggtacatgtttgagagcaagagtatgaaacttagaactcaaatacctgcagaaatgctagcaagcatcgatttgaaatacttcaatgattcaactagaaagaagattgaaaaaatccggccgctcttaatagatgggactgcatcattgagccctggaatgatgatgggcatgttcaatatgttaagtactgtattaggcgtctccatcctgaatcttggacaaaagagacacaccaagactacttactggtgggatggtcttcaatcttctgatgattttgctctgattgtgaatgcacccaatcatgaagggattcaagccggagtcaacaggttttatcgaacctgtaagctacttggaattaatatgagcaagaaaaagtcttacataaacagaacaggtacatttgaattcacaagttttttctatcgttatgggtttgttgccaatttcagcatggagcttcccagctttggggtgtctgggatcaacgagtctgcggacatgagtattggagttactgtcatcaaaaacaatatgataaacaatgatcttggtccagcaacagctcaaatggcccttcagctgttcatcaaagattacaggtacacgtaccggtgccatagaggtgacacacaaatacaaacccgaagatcatttgaaataaagaaactgtgggagcaaacccattccaaagctggactgctggtctccgacggaggcccaaatttatacaacattagaaatctccacattcctgaagtctgcttgaaatgggaattaatggatgaggattaccaggggcgtttatgcaacccactgaacccatttgtcaaccataaagaaattgaatcagtgaacaatgcagtgatgatgccagcacatggtccagccaaaaacatggagtatgatgctgttgcaacaacacactcctggatccccaaaagaaatcgatccatcttgaatacaagccaaagaggaatacttgaagatgaacaaatgtaccaaaagtgctgcaatttatttgaaaaattcttccccagcagttcatacagaagaccagtcgggatatccagtatggtggaggctatggtttccagagcccgaattgatgcacgaattgatttcgaatctggaaggataaagaaagaggagttcactgagatcatgaagatctgttccaccattgaagagctcagacggcaaaaatagtgaatttagcttgtccttcatgaaaannnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/Ohio/23/19351" spec="Sequence" taxon="A/swine/Ohio/23/1935" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnngaatggatgtcaatccgactttgcttttcctgaaagtgccagcgcaaaatgctataagcacaacgttcccttacactggagaccctccttacagccatgggacaggaacaggatataccatggatactgtcaacagaacacatcagtactcagaaaagggaaaatggacaacaaacactgaaactggagcaccacaactaaacccgattgatggaccactgccagaagataatgaaccgagtggttatgcccaaacagattgtgtattggaagcaatggctttccttgagaagtctcatcccggtatctttgaaaactcatgccttgagacgatggaagttgttcagcagacacgagtggacaagctgacgcaaggccgacaracctatgactggactctaaataggaaccagcctgctgcaacagcattggccaacacaatagaagtgttcagactaaatggcctcacggccaatgagtctggaaggctcatagacttcctcaaggatgttatggagtcgatggacaaagaagaagtggaaatcacaacccattttcagmgaaaaagaagagtgagagacaacatgactaagaaaatggtgacgcagagaacaataggtaaaaagaagcagaagttgaacaaaagaagttatctaatcagggcactgaccctgaacacaatgacaaaagatgctgagagagggaagctaaaaaggagagcgattgccaccccagggatgcaaatacggggatttgtatattttgttgagacactggcaagaaatatatgtgaaaaacttgaacaatcaggactgccagttgggggtaatgagaagaaagccaagttggcaaatgttgtaagaaaaatgatgaccaattctcaggacactgagctttctttcaccatcactggagataacaccaaatggaatgaaaatcagaatcctcggatgtttttggctatgatcacgtacataaccagaaatcaacccgaatggttcagaaatgttctgagtattgctccaataatgttctcaaataaaatggcaagattggggaaggggtacatgttcgagagcaagagcatgaagcttagaactcaagtacctgcagagatgctatcgggcatcgacttgaaatatttcaatgattcaacaagggaaaaaattgaaaaaatccgaccgctcttaatggatggagctgcatcattaagccccggaatgatgatgggtatgtttaatatgttaagcactgtattgggtgtttccatcctgaatcttgggcaaaagaagtacaccaagactacttactggtgggatggtcttcaatcttctgatgattttgctctgattgtgaatgcacccgaccatgagggaattcaagccggagtcgataggttttatcgaacctgtaagctccttggaatcaatatgagcaaaaagaagtcttacataaatagaacgggcacatttgaattcacaagctttttctatcgctacgggtttgttgccaatttcagtatggagcttcctagttttggggtatctgggatcaatgagtctgcagacatgagtattggggttactgtcatcaaaaacaatatgataaacaatgatcttggaccagcaacagcccaaatggccctccagttgttcatcaaagattacaggtacacgtaccggtgccacaggggtgacactcaaatacaaacccgaagatcatttgaaataaagaaactgtgggatcaaacccgttcaaaggctggactgctggtctccgatggaggccccaatttatacaatattagaaatctccacattcctgaagtctgcttgaaatgggaattgatggatgaggattaccaggggcgtttgtgcaatccgctgaatccatttgtcagccataaagagattgaatcagtgaataacgcagtggtaatgccagcacatggtccagccaaaaccatggaatatgatgctgttgctacaacacactcctggattcccaaaagaaatcgatccatcttgaacacaagccagagaggaatacttgaagacgagcaaatgtaccaaaaatgctgcaacctatttgaaaatttcttccctagcagctcatacaggagaccagtcgggatttccagtatggtggaggccatggtttctagggcccgaattgatgcacgcattgattttgaatctggaaggataaagaaagaggatttcgctgagatcatgaagatctgttccaccattgaagatctcagacggcaaaagtagtgaatttagcttgtccttcatgannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/USA/1976/19311" spec="Sequence" taxon="A/swine/USA/1976/1931" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnatggatgtcaatccgactttgcttttcctgaaagtgccagcgcaaaatgctataagcacaacgttcccttacactggagaccctccttacagccatgggacaggaacaggatataccatggatactgtcaacagaacacatcagtactcagaaaagggaaaatggacaacaaacactgaaactggagcaccacaactaaacccgattgatggaccactgccagaagataatgaaccgagtggttatgcccaaacagattgtgtattggaagcaatggctttccttgagaagtcccaccccggtatctttgaaaactcatgccttgaaacgatggaagttgttcagcaaacacgagtggacaagctgacgcaaggccgacagacctatgactggactctaaataggaaccagcctgctgcaacagcattggccaacacaatagaagtgttcagattaaatggcctcacggccaatgaatctgggaggctcatagacttcctcaaggatgttatggagtcgatggacaaaggagaaatggaaatcacaacccattttcagagaaaaagaagagtgagagacaacatgactaagaaaatggtgacgcagagaacaataggtaaaaagaagcagaggttgaacaaaagaagttacctaatcagggcactgaccctgaacacaatgacaaaagatgctgagagagggaagctaaaacggagagcgattgccacccccgggatgcaaatacggggatttgtatattttgttgagacactggcaaggaatatatgtgaaaaacttgaacaatcaggactgccagttggaggtaatgagaagaaagccaagttggcaaatgttgtaagaaaaatgatgaccaattctcaggacactgagctttctttcaccatcactggagataacaccaaatggaatgaaaatcagaatcctcggatgtttttggctatgatcacgtacataaccagaaatcagcccgaatggttcaggaatgttctgagtattgctccaataatgttctcaaataaaatggcaagattggggaaggggtacatgttcgagagcaagagtatgaagcttagaactcaagtacctgcagagatgctatcaagcatcgacttgaaatatttcaatgattcaacaaggaaaaaaattgaaaaaatccgaccgctcttaatagatgggactgcatcattaagccccggaatgatgatgggtatgtttaatatgttaagcactgtattgggtgtttccatcctgaatcttgggcaaaagaaatacaccaagactgcctactggtgggatggtcttcaatcttctgatgattttgctctgattgtgaatgcacccaatcatgagggaattcaagccggagtcgacaggttttatcgaacctgtaagctacttggaatcaacatgagcaaaaaaaagtcttacataaatagaacgggcacatttgaattcacaagctttttctatcgctacgggtttgttgccaatttcagcatggagcttcctagttttggggtatctgggatcaacgagtctgcagacatgagtattggggtcactgtcatcaaaaacaatatgataaacaatgatcttggtccagcaacagcccaaatggccctccagttgttcatcaaagattacagatacacgtaccggtgtcacaggggtgacactcaaatacaaacccgaagatcatttgaaataaagaaactgtgggatcaaacccgttcaaaggctggactgctggtctccgatggaggctccaatttatacaatattagaaatctccacattcctgaagtctgcttgaaatgggaattgatggatgaggattacaaggggcgtttgtgcaatccgctgaatccatttgtcagccataaagagattgaatcagtgaataacgcagtggtgatgccagcacatggtccagccaaaaccatggaatatgatgctgttgctacaacacactcctggattcccaaaagaaatcgatccatcttgaacacgagccagagaggaatacttgaagatgagcaaatgtaccaaaaatgctgcaacctatttgaaaagttcttccccagcagctcatacaggagaccagtcgggatttccagtatggtggaggccatggtttctagggcccgaattgatgcacgcattgatttcgaatctgggaggataaagaaagaggatttcgctgagatcatgaagatctgttccaccattgaagatctcagacggcaaaagtagtgaatttagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                    </data>
<data
id="alignedSegment6"
spec="Alignment"
name="alignment">
                        <sequence id="seq_A/Brevig_Mission/1/19185" spec="Sequence" taxon="A/Brevig_Mission/1/1918" totalcount="4" value="nnnnnnnnnnnnnnnnnnnatgaatccaaatcaaaaaataataaccattgggtcaatctgtatggtagtcggaataattagcctaatattgcaaatagggaatataatctcaatatgggttagccattcaattcaaactggaaatcaaaaccatcctgaaacatgcaaccaaagcatcattacctatgaaaataacacctgggtgaatcaaacatatgttaacattagcaatactaacgttgttgctggacaggatgcaacttcagtgatattaaccggcaattcctctctttgtcccatcagtgggtgggctatatacagcaaagacaatggcataagaattggttccaaaggagacgtttttgtcataagagagccatttatttcatgctctcacttggaatgcaggaccttttttctgactcaaggcgccttgctgaatgacaagcattcaaatgggaccgtcaaggacagaagcccctatagaaccttaatgagctgccctgttggtgaagctccgtctccgtacaattcaaggttcgaatcggttgcttggtcagcaagtgcatgccatgatggcatgggctggctaacaatcggaatttcaggtccagataatggagcagtggctgtattaaaatacaacggtataataacagacaccatcaaaagttggaggaacaacatattgagaacgcaagagtctgaatgtgcctgtgtaaatggttcatgttttactataatgaccgatggcccaagtaatgggcaggcctcgtacaaaattttaaagatagagaaggggaaggttactaaatcaattgagttgaatgcacctaattaccactacgaggaatgttcctgttaccctgatacaggtaaagtgatgtgtgtgtgcagagacaattggcatggttcgaatcgaccatgggtgtctttcgatcaaaacctggattatcaaatagggtacatctgcagtggggttttcggtgacaatccgcgtcccaatgatggaacaggcagctgtggtccagtgtcttctaatggagcaaatggaataaagggattttcatttaggtatgataatggtgtttggataggaagaactaaaagtaccagttccagaagcgggtttgagatgatttgggatcctaatggatggacagagactgatagtagtttctctgtgagacaagatattgtagcaataactgattggtcggggtacagcgggagtttcgttcaacatcctgagctaacagggctggactgcatgaggccttgcttctgggttgaattaatcaggggacaacctaaagagaatacaatctggactagtgggagcagcatttccttttgtggcgtaaatagtgatactgtaggttggtcttggccagacggtgctgagttgccattcagcattgacaagtagnnnnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/Hickox/19405" spec="Sequence" taxon="A/Hickox/1940" totalcount="4" value="nnnnnnnnnnnnnnnnnnaatgaatccaaatcagaaaataataaccattggatcaatctgtatggtagtcggaataattagcctaatattgcaaatagggaatattgtctcaatatggattagccattcaattcaaactggaaatcaaaaccatactggaacttgcaaccaaagcatcattacctataaaaatagcacctgggtaaatcagacatatgtcaatattagcaacactaacgttgttgctgggaaggatacaacttcagtgatattagccggcaattcatctctttgccctatccgtgggtgggctatatacagcaaagataatggcgtaagaattggttccaaaggagatgtttttgtcataagagaaccctttatttcatgttctcacttggaatgcaggaccttttttctgacccaaggcgccctgttgaatgacaagcattcaaatgggaccgttaaggacagaagcccttatagggccttaatgagctgccctgttggtgaagctccgtccccgtacaattcaaggtttgaatcggttgcttggtcagcaagtgcatgtcatgatggcatgggctggctaacaatcggaatttctggtccagatgatggagcagtggctgtgttaaaatacaacggcataataactgaaaccataaaaagttggaggaaggaaatattgagaacacaagagtctgaatgtgtctgcgtaaatggttcatgtttcactataatgaccgacggcccgagtggtgggccggcctcgtacaaaattttcaagatcgagaaggggaaggttactaaatcaatagagttggatgcacctaattctcactacgaggaatgttcctgctaccctgataccagcaaggtgatgtgtgtgtgcagagacaattggcacggttcgaaccgaccatgggtgtctttcgatcaaaatctggattatcaaatgggatacatctgcagtggggttttcggtgacaatccgcgtcccaaagatggaaaaggcagctgtggtccagtgtatgttgatggagcaaacggagtaaagggattttcatacaggtatggtaatggtgtttggataggaaggactaaaagtaacagttccagacaggggtttgagatgatttgggatcctaatgggtggacagagactgatagtaatttctttatgaaacaagatgtagtggcagtaaccgattggtcagggtacagcggaagtttcgttcaacatcctgagctaacagggctggactgtatgaggccttgcttctgggttgaattaatcaggggacgacctaaagaaaatacaatctggaccagtgggagcagcatttctttttgtggtgtgaatagtgatactgtagattggtcttggccagacggtgccgagttgccattcaccattgacaagtagtttgttcaaaaaannnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/WSN/19335" spec="Sequence" taxon="A/WSN/1933" totalcount="4" value="agcgaaagcaggagtttaaatgaatccaaaccagaaaataataaccattgggtcaatctgtatggtagtcggaataattagcctaatattgcaaataggaaatataatctcaatatggattagccattcaattcaaaccggaaatcaaaaccatactggaatatgcaaccaaggcagcattacctannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntaaagttgttgctgggcaggactcaacttcagtgatattaaccggcaattcatctctttgtcccatccgtgggtgggctatacacagcaaagacaatggcataagaattggttccaaaggagacgtttttgtcataagagagccttttatttcatgttctcacttggaatgcaggaccttttttctgactcaaggcgccttactgaatgacaagcattcaagggggacctttaaggacagaagcccttatagggccttaatgagctgccctgtcggtgaagctccgtccccgtacaattcaaggtttgaatcggttgcttggtcagcaagtgcatgtcatgatggaatgggctggctaacaatcggaatttctggtccagatgatggagcagtggctgtattaaaatacaaccgcataataactgaaaccataaaaagttggaggaagaatatattgagaacacaagagtctgaatgtacctgtgtaaatggttcatgttttaccataatgaccgatggcccaagtgatgggctggcctcgtacaaaattttcaagatcgagaaggggaaggttactaaatcgatagagttgaatgcacctaattctcactacgaggaatgttcctgttaccctgataccggcaaagtgatgtgtgtgtgcagagacaattggcacggttcgaaccgaccatgggtgtccttcgaccaaaacctagattataaaataggatacatctgcagtggggttttcggtgacaacccgcgtcccaaagatggaacaggcagctgtggcccagtgtctgctgatggagcaaacggagtaaagggattttcatataagtatggcaatggtgtttggataggaaggactaaaagtgacagttccagacatgggtttgagatgatttgggatcctaatggatggacagagactgatagtaggttctctatgagacaagatgttgtggcaataactaatcggtcagggtacagcggaagtttcgttcaacatcctgagctaacagggctagactgtatgaggccttgcttctgggttgaattaatcagggggctacctgaggaggacgcaatctggactagtgggagcatcatttctttttgtggtgtgaatagtgatactgtagattggtcttggccagacggtgctgagttgccgttcaccattgacaagtagtttgttcaaaaaactccttgtttctact"/>
                        <sequence id="seq_A/Wilson-Smith/19335" spec="Sequence" taxon="A/Wilson-Smith/1933" totalcount="4" value="nnnnnnnnnnnnnntttaaatgaatccaaaccagaaaataataaccattgggtcaatctgtatggtagtcggaataattagcctaatattgcaaatagggaatataatctcaatatggattagccattcaattcaaaccggaaatcaaaaccatactggaatatgcaaccaaggcatcattacctannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntaacgttgttgctgggcaggactcaacttcagtgatattaaccggcaattcatctctttgtcccatccgtgggtgggctatacacagcaaagacaatggcataagaattggttccaaaggagacgtttttgtcataagagagccttttatttcatgttctcacttggaatgcaggaccttttttctgactcaaggcgccttactgaatgacaagcattcaaatgggaccgttaaggacagaagcccttatagggccttaatgagctgccctgtcggtgaagctccgtccccgtacaattcaaggtttgaatcggttgcttggtcagcaagtgcatgtcatgatggcatgggctggctaacaatcggaatttctggtccagataatggagcagtggctgtattaaaatacaacggcataataactgaaaccataaaaagttggaggaagaaaatattgagaacacaagagtctgaatgtacctgtgtaaatggttcatgttttaccataatgaccgatggcccaagtaatgggctggcctcgtacaaaattttcaagatcgagaaggggaaggttactaaatcaatagagttgaatgcacctaattctcactacgaggaatgttcctgttaccctgataccggcaaagtgatgtgtgtgtgcagagacaattggcacggttcgaaccgaccatgggtgtccttcgaccaaaacctagattatcaaataggatacatctgcagtggggttttcggtgacaacccgcgtcccaaagatggaacaggcagctgtggcccagtgtctgctgatggagcaaacggagtaaagggattttcatataggtatggtaatggtgtttggataggaaggactaaaagtgacagttccagacatgggtttgagatgatttgggatcctaatggatggacagagactgatagtaggttctctgtgagacaagatgttgtggcaatgactgatcggtcagggtacagcggaagtttcgttcaacatcctgagctaacagggctagactgtatgaggccttgcttctgggttgaattaatcaggggacgacctgaggaggaaacaatctggactagtgggagcatcatttctttttgtggcgtgaatagtgatactgtagattggtcttggccagacggtgctgagttgccgttcaccattgacaagtagtctgttcaaaaaannnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/Ohio/23/19355" spec="Sequence" taxon="A/swine/Ohio/23/1935" totalcount="4" value="nnnnnnnnnnnnntttaaaatgaatacaaatcaaagaataataaccattgggtcaatctgtctaatagttggaataattagcctattattacagatagggaatataatctcattatggattagccattcaattcaaactagaggtcaaaaccatcctgaaatatgcaaccaaagcatcattacctatgaaaacaacacatgggtgaatcaaacatatgttaacattagcaatgctaacattgttgctggacaggatgcaacttcaatgatactagccggcaattcctctctttgccccatcagtgggtgggctatatacagcaaagacaatggcataagaattggttccaagggagacatttttgtcataagagagccgtttatttcatgctctcacttggaatgcagaaccttttttctgactcaaggcgctttgctgaatgacaagcattcaaatggaaccgtcaaggacagaagcccttatagaaccttaatgagctgccctattggtgaagctccgtccccgtacaattcaaggttcgaatcggttgcttggtcagcaagtgcatgccatgatggcatgagctggctaacaatcggaatttccggtccagataatggagcagtggctgtattaaaatacaatggtataataacagataccatcaaaagttggaggaacaaaatattgagaacgcaagagtctgagtgtgcctgtataaatggttcatgttttactataatgaccgatggcccaagtaatgggcaggcctcgtacaaaatcttcaagatagagaaggggagaattattaaatcaattgagttgaatgcacctaattaccactacgaggaatgctcctgttatcctgatacaagtaaagtaatgtgtgtgtgcagagacaactggcatggttcgaaccggccatgggtgtctttcgatcaaaatctggattatcaaatagggtacatctgcagtggggttttcggtgacaacccgcgttccaatgatggaacaggcagctgtggtccagtgccttctaatggagcaaatggagtaaaagggttttcgtttagatatggcaatggtgtttggataggaagaactaaaagtatcagttccagaagcggatttgagatgatttgggatcctaatgggtggacagagactgatagtagtttctctgtgaaacaagatattgtagcaacaactgattggtcaggatacagcggaagtttcgttcaacatcctgaactaacaggactggactgcataaggccttgcttctgggttgagttaatcagaggacaacctaaggagaacacaatctggactagtgggagcagcatttccttttgtggcgtgaatggtggtactgtagactggtcatggccagacggcgctgagttgccattcaccattgacaagtagtttgttcannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/USA/1976/19315" spec="Sequence" taxon="A/swine/USA/1976/1931" totalcount="4" value="nnnnnnnnnnnnnnnnnnnatgaatacaaatcaaaaaataataaccattgggtcaatctgtctaatagttggaataactagcctaatattacaaatagggaatataatctcaatatggattagccattcaattcaaactagagatcaaaaccatcctgaaacatgcaaccaaagcatcattacctatgaaaacaacacatgggtgaatcaaacatatgctaacattagcaatgctaacattattgctggaaaggatgcaacttcaatgatattagccggcaattcctctctttgccccatcagtgggtgggctatatacagcaaagacaatggcataagaattggttccaaaggagacatttttgtcataagagagccgtttatttcatgctctcacttggaatgcagaaccttttttctgactcaaggcgctttgctgaatgacaagcattcaaatggaaccgtcaaggacagaagcccttatagaaccttaatgagctgccctattggtgaagctccatctccgtacaattcaaggttcgaatcggttgcttggtcagcaagtgcatgccatgatggcatgagctggctaacaatcggaatttccggtccagataatggagcagtggctgtattaaaatacaatggtataataacagataccatcaaaagttggaggaacaaaatactgagaacgcaagagtctgaatgtgcctgtgtaaatggttcatgttttactataatgaccgatggcccaagtaatgggcaggcctcgtacaaaatcttcaagatagagaaggggaggattattaaatcaattgagttgaatgcacctaattaccactacgaggaatgctcctgttatcctgatgcaagtaaagtaatgtgtgtgtgcagagacaactggcatggttcgaaccgaccatgggtgtctttcgatcaaaatctggattatcaaatagggtacatctgcagtggggttttcggtgacaacccgcgttccaatgatggaacaggcagctgtggtccagtgtcttctaatggagcaaatggggtaaaaggattttcgtttagatatggcaatggtgtttggataggaagaactaaaagtatcagttccagaaacggatttgagatgatttgggatcctaatgggtggacagagactgatagtagtttctctgtgaaacaagatattgtagcaataactgattggtcagggtacagcgggagtttcgttcaacatcctgaactaacaggactggactgcataaggccttgcttctgggttgagttaatcagaggacaacctaaggagaacacaatctggactagtgggagcagcatttccttttgtggcgtgaatagtgatactgtaggctggtcttggccagacggcgctgagttgccattcaccattgacaagtagtttnnnnnnnnnnnnnnnnnnnnnnnnn"/>
                    </data>
<data
id="alignedSegment8"
spec="Alignment"
name="alignment">
                        <sequence id="seq_A/Brevig_Mission/1/19187" spec="Sequence" taxon="A/Brevig_Mission/1/1918" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnnatggattccaacactgtgtcaagctttcaggtagactgctttctttggcatgtccgcaaacggtttgcagaccaagaactgggtgatgccccattccttgatcggcttcgccgagatcagaagtccctaagaggaagaggcagcactcttggtctggacatcgagacagccacccgtgctggaaagcagatagtggagcggattctgaaggaagaatccgatgaggcacttaaaatgaccattgcctctgtacctgcttcgcgctacctaactgacatgactcttgaggagatgtcaagggactggttcatgctcatgcccaagcagaaagtggcaggctctctttgtatcagaatggaccaggcgatcatggataagaacatcatactgaaagcgaacttcagtgtgattttcgaccggctggagactctaatactactaagggctttcaccgaagagggagcaattgttggcgaaatttcaccattgccttctcttccaggacatactgatgaggatgtcaaaaatgcagttggggtcctcatcggaggacttgaatggaatgataacacagttcgagtctctgaaactctacagagattcgcttggagaagcagtaatgagaatgggagacctccactccctccaaaacagaaacggaaaatggcgagaacaattaagtcagaagtttgaagaaataagatggttgattgaagaagtgagacatagactgaagataacagagaatagttttgagcaaataacatttatgcaagccttacaactattgcttgaagtggagcaagagataagaactttctcgtttcagcttatttaannnnnnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/Hickox/19407" spec="Sequence" taxon="A/Hickox/1940" totalcount="4" value="nnnnnnnnnnnnnnnnnnnagacataatggatcccaacactgtgtcaagctttcaggtagattgctttctttggcatgtccgcaaacgagttgcagaccaagaactaggtgatgccccattccttgatcggcttcgccgagatcagaagtccctaaagggaagaggcagcactctcggtctgaacatcgaaacagccacccgtgttggaaagcagatagtggagagaattctgaaggaagaatccgatgaggcacttaaaatgaccatggcctctgcacctgcttcgcgctacctaactgacatgactattgaggaaatgtcaagggactggttcatgctcatgcccaagcagaaagtggcaggccctctttgtatcagaatggaccaggcggtcatggataagagcatcatactgaaagcgaatttcagtgtgatttttgaccggctggagactctaatattactaagggctttcaccgaagagggagcaattgttggcgaaatttcaccattgccttctcttccaggacatactaatgaggatgtcaaaaatgcaattggagtcctcatcggaggacttgaatggaatgataacacagttcgagtctctaaaactctacagagattcgcttggagaagcagtaatgagaatgggggacctccactcactccaaaacagaaacggaaaatggcgagaacaattaggtcagaagttcgaagaaataagatggttgattgaagaagtgagacacagattgaaaataacagagaatagttttgagcaaataacatttatgcaagccttacagctattgtttgaagtggagcaagagataagaactttctcgtttcagcttatttaannnnnnnnnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/WSN/19337" spec="Sequence" taxon="A/WSN/1933" totalcount="4" value="agcaaaagcagggtgacaaagacataatggatccaaacactgtgtcaagctttcaggtagattgctttctttggcatgtccgcaaaagagttgcagaccaagaactaggtgatgccccattccttgatcggcttcgccgagatcagaagtccctaagaggaagaggcagcactcttggtctggacatcgaaacagccacccgtgctggaaagcaaatagtggagcggattctgaaggaagaatctgatgaggcactcaaaatgaccatggcctctgtacctgcatcgcgctacctaactgacatgactcttgaggaaatgtcaaggcactggttcatgctcatgcccaagcagaaagtggcaggccctctttgtatcagaatggaccaggcgatcatggataagaacatcatactgaaagcgaacttcagtgtgatttttgaccggctggagactctaatattactaagggccttcaccgaagaggggacaattgttggcgaaatttcaccactgccctctcttccaggacatactgatgaggatgtcaaaaatgcagttggggtcctcatcggaggacttgaatggaataataacacagttcgagtctctgaaactctacagagattcgcttggagaagcagtaatgagaatgggagacctccactcactccaaaacagaaacggaaaatggcgggaacaattaggtcagaagtttgaagaaataagatggttgattgaagaagtgagacacagactgaagataacagagaatagttttgagcaaataacatttatgcaagccttacaactattgcttgaagtggagcaagagataagaactttctcgtttcagcttatttaataataaaaaacacccttgtttctact"/>
                        <sequence id="seq_A/Wilson-Smith/19337" spec="Sequence" taxon="A/Wilson-Smith/1933" totalcount="4" value="nnnnnnnnnnnnntgacaaagacataatggatccaaacactgtgtcaagctttcaggtagattgctttctttggcatgtccgcaaaagagttgcagaccaagaactaggtgatgccccattccttgatcggcttcgccgagatcagaagtccctaagaggaagaggcagcactctcggtctggacatcgaaacagccacccgtgctggaaagcaaatagtggagcggattctgaaggaagaatccgatgaggcacttaaaatgaccatggcctctgtacctgcatcgcgctacctaactgacatgactcttgaggaaatgtcaaggcactggttcatgctcatgcccaagcagaaagtggcaggccctctttgtatcagaatggaccaggcgatcatggataagaacatcatactgaaagcgaacttcagtgtgatttttgaccggctggagactctaatattactaagggccttcaccgaagagggaacaattgttggcgaaatttcaccactgccttctcttccaggacatactgatgaggatgtcaaaaatgcagttggggtcctcatcggaggacttgaatggaataataacacagttcgagtctctgaaactctacagagattcgcttggagaagcagtaatgagaatgggagacctccactcactccaaaacagaaacggaaaatggcgggaacaattaggtcagaagtttgaagaaataagatggttgattgaagaagtgagacacagactgaagataacagagaatagttttgagcaaataacatttatgcaagccttacaactattgcttgaagtggagcaagagataagaactttctcgtttcagcttatttaatgataaaaaannnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/Ohio/23/19357" spec="Sequence" taxon="A/swine/Ohio/23/1935" totalcount="4" value="nnnnnnnnnnnnnnnacaaagacataatggatttcaacactgtgtcaagctttcaggtagactgctttctttggcatgtccgcaaacggtttgcagacaataaattgggtgatgccccattccttgatcggctccgccgagatcaaaagtccctaataggaagaggcagcacccttggtctggacatcgagacagccacccgtgctggaaagcagatagtggagcggattctggaggaagaatccgacggggcacttaagatgaccattgcctctgtacctgcttcgcgttacctagctgacatgactcttgaggagatgtcaagggactggttcatgctcatgcccaagcaaaaggtggcaggctctctttgtataagaatggatcaggcgatcatggaaaagagcatcatactgaaagcgaacttcagtgtgattttcgaccggttggagactttaatactactaagggctttcaccgaagagggagcaattgttggcgaaatttcaccattgccttctcttccaggacatactgatgaggatgtcaaaaatgcagttggggtcctcatcggagggcttgaatggaatggtaacaaagttcgagtctctgaaaatctacagagattcgcttggagaagccgtaatgagaatgggagaccttcactacctccaaaacagaaatggaaaatggcgggaacaattaggtcagaaatttgaagaaataagatggttgattgaagaagtgagacacagactgaagataacagagaatagtttcgagcaaataacatttatgcaagccttacaactattgcttgaagtggagcaagagataagaactttctcgtttcagcttatttaataataannnnnnnnnnnnnnnnnnnn"/>
                        <sequence id="seq_A/swine/USA/1976/19317" spec="Sequence" taxon="A/swine/USA/1976/1931" totalcount="4" value="nnnnnnnnnnnnnnnnnnnnnnnnnnatggattccaacactgtgtcaagctttcaggtagactgctttctttggcatgtccgcaaacggtttgcagacaaaaaattgggtgatgccccattccttgatcggctccgccgagatcaaaagtctctaagaggaagaggcagcacccttggtctggacatcgagacagccacccgtgctggaaagcagatagtggagcggattctggaggaagaatccaacggggcacttaaaatgaccattgcctctgtacctgcttcgcgttacctaactgacatgactcttgaggaaatgtcaagggactggttcatgctcatgcccaagcaaaaagtggcaggctctctttgtataagaatggaccaggcgatcatggaaaagagcatcatactgaaagcgaacttcagtgtgattttcgaccggttggagactttaatactactaagggctttcaccgaagagggagcaattgttggcgaaatttcaccattgccttctcttccaggatatactgatgaggatgtcaaaaatgcagttggggtcctcatcggagggcttgaatggaatggtaacacggttcgagtctctgaaaatctacagagattcgcttggagaagccgtaatgagaacgggagaccttcactacctccaaaacagaaatgggaagtggcgggaacaattaggtcagaagtttgaagaaataagatggttgattgaagaagtgagacacagactgaagataacagagaatagtttcgagcaaataacatttatgcaagccttgcaactattgcttgaagtggagcaagagataagaactttctcgtttcagcttatttaataataannnnnnnnnnnnnnnnnnnn"/>
                    </data>


    


    


    
<map name="Uniform" >beast.math.distributions.Uniform</map>
<map name="Exponential" >beast.math.distributions.Exponential</map>
<map name="LogNormal" >beast.math.distributions.LogNormalDistributionModel</map>
<map name="Normal" >beast.math.distributions.Normal</map>
<map name="Beta" >beast.math.distributions.Beta</map>
<map name="Gamma" >beast.math.distributions.Gamma</map>
<map name="LaplaceDistribution" >beast.math.distributions.LaplaceDistribution</map>
<map name="prior" >beast.math.distributions.Prior</map>
<map name="InverseGamma" >beast.math.distributions.InverseGamma</map>
<map name="OneOnX" >beast.math.distributions.OneOnX</map>


<run id="mcmc" spec="MCMC" chainLength="5000000">
    <state id="state" spec="State" storeEvery="5000">
        <tree id="Tree.t:alignedSegment1" spec="beast.evolution.tree.Tree" name="stateNode">
            <trait id="dateTrait.t:alignedSegment1" spec="beast.evolution.tree.TraitSet" traitname="date" value="A/Brevig_Mission/1/1918=1918,A/Hickox/1940=1940,A/Wilson-Smith/1933=1933,A/swine/USA/1976/1931=1931,A/swine/Ohio/23/1935=1935,A/WSN/1933=1933">
                <taxa id="TaxonSet.alignedSegment1" spec="TaxonSet">
                    <alignment idref="alignedSegment1"/>
                </taxa>
            </trait>
            <taxonset idref="TaxonSet.alignedSegment1"/>
        </tree>
        <tree id="Tree.t:alignedSegment4" spec="beast.evolution.tree.Tree" name="stateNode">
            <trait id="dateTrait.t:alignedSegment4" spec="beast.evolution.tree.TraitSet" traitname="date" value="A/Brevig_Mission/1/1918=1918,A/Hickox/1940=1940,A/Wilson-Smith/1933=1933,A/swine/USA/1976/1931=1931,A/swine/Ohio/23/1935=1935,A/WSN/1933=1933">
                <taxa id="TaxonSet.alignedSegment4" spec="TaxonSet">
                    <alignment idref="alignedSegment4"/>
                </taxa>
            </trait>
            <taxonset idref="TaxonSet.alignedSegment4"/>
        </tree>
        <parameter id="clockRate.c:alignedSegment4" spec="parameter.RealParameter" lower="0.001" name="stateNode" upper="0.0025">0.0014</parameter>
        <tree id="Tree.t:alignedSegment5" spec="beast.evolution.tree.Tree" name="stateNode">
            <trait id="dateTrait.t:alignedSegment5" spec="beast.evolution.tree.TraitSet" traitname="date" value="A/Brevig_Mission/1/1918=1918,A/Hickox/1940=1940,A/Wilson-Smith/1933=1933,A/swine/USA/1976/1931=1931,A/swine/Ohio/23/1935=1935,A/WSN/1933=1933">
                <taxa id="TaxonSet.alignedSegment5" spec="TaxonSet">
                    <alignment idref="alignedSegment5"/>
                </taxa>
            </trait>
            <taxonset idref="TaxonSet.alignedSegment5"/>
        </tree>
        <parameter id="clockRate.c:alignedSegment5" spec="parameter.RealParameter" lower="0.001" name="stateNode" upper="0.0025">0.0014</parameter>
        <tree id="Tree.t:alignedSegment7" spec="beast.evolution.tree.Tree" name="stateNode">
            <trait id="dateTrait.t:alignedSegment7" spec="beast.evolution.tree.TraitSet" traitname="date" value="A/Brevig_Mission/1/1918=1918,A/Hickox/1940=1940,A/Wilson-Smith/1933=1933,A/swine/USA/1976/1931=1931,A/swine/Ohio/23/1935=1935,A/WSN/1933=1933">
                <taxa id="TaxonSet.alignedSegment7" spec="TaxonSet">
                    <alignment idref="alignedSegment7"/>
                </taxa>
            </trait>
            <taxonset idref="TaxonSet.alignedSegment7"/>
        </tree>
        <parameter id="clockRate.c:alignedSegment7" spec="parameter.RealParameter" lower="0.001" name="stateNode" upper="0.0025">0.0014</parameter>
        <tree id="Tree.t:alignedSegment3" spec="beast.evolution.tree.Tree" name="stateNode">
            <trait id="dateTrait.t:alignedSegment3" spec="beast.evolution.tree.TraitSet" traitname="date" value="A/Brevig_Mission/1/1918=1918,A/Hickox/1940=1940,A/Wilson-Smith/1933=1933,A/swine/USA/1976/1931=1931,A/swine/Ohio/23/1935=1935,A/WSN/1933=1933">
                <taxa id="TaxonSet.alignedSegment3" spec="TaxonSet">
                    <alignment idref="alignedSegment3"/>
                </taxa>
            </trait>
            <taxonset idref="TaxonSet.alignedSegment3"/>
        </tree>
        <parameter id="clockRate.c:alignedSegment3" spec="parameter.RealParameter" lower="0.001" name="stateNode" upper="0.0025">0.0014</parameter>
        <tree id="Tree.t:alignedSegment2" spec="beast.evolution.tree.Tree" name="stateNode">
            <trait id="dateTrait.t:alignedSegment2" spec="beast.evolution.tree.TraitSet" traitname="date" value="A/Brevig_Mission/1/1918=1918,A/Hickox/1940=1940,A/Wilson-Smith/1933=1933,A/swine/USA/1976/1931=1931,A/swine/Ohio/23/1935=1935,A/WSN/1933=1933">
                <taxa id="TaxonSet.alignedSegment2" spec="TaxonSet">
                    <alignment idref="alignedSegment2"/>
                </taxa>
            </trait>
            <taxonset idref="TaxonSet.alignedSegment2"/>
        </tree>
        <parameter id="clockRate.c:alignedSegment2" spec="parameter.RealParameter" lower="0.001" name="stateNode" upper="0.0025">0.0014</parameter>
        <tree id="Tree.t:alignedSegment6" spec="beast.evolution.tree.Tree" name="stateNode">
            <trait id="dateTrait.t:alignedSegment6" spec="beast.evolution.tree.TraitSet" traitname="date" value="A/Brevig_Mission/1/1918=1918,A/Hickox/1940=1940,A/Wilson-Smith/1933=1933,A/swine/USA/1976/1931=1931,A/swine/Ohio/23/1935=1935,A/WSN/1933=1933">
                <taxa id="TaxonSet.alignedSegment6" spec="TaxonSet">
                    <alignment idref="alignedSegment6"/>
                </taxa>
            </trait>
            <taxonset idref="TaxonSet.alignedSegment6"/>
        </tree>
        <parameter id="clockRate.c:alignedSegment6" spec="parameter.RealParameter" lower="0.001" name="stateNode" upper="0.0025">0.0014</parameter>
        <tree id="Tree.t:alignedSegment8" spec="beast.evolution.tree.Tree" name="stateNode">
            <trait id="dateTrait.t:alignedSegment8" spec="beast.evolution.tree.TraitSet" traitname="date" value="A/Brevig_Mission/1/1918=1918,A/Hickox/1940=1940,A/Wilson-Smith/1933=1933,A/swine/USA/1976/1931=1931,A/swine/Ohio/23/1935=1935,A/WSN/1933=1933">
                <taxa id="TaxonSet.alignedSegment8" spec="TaxonSet">
                    <alignment idref="alignedSegment8"/>
                </taxa>
            </trait>
            <taxonset idref="TaxonSet.alignedSegment8"/>
        </tree>
        <parameter id="clockRate.c:alignedSegment8" spec="parameter.RealParameter" lower="0.001" name="stateNode" upper="0.0025">0.0014</parameter>
        <parameter id="clockRate.c:alignedSegment1" spec="parameter.RealParameter" lower="0.0015" name="stateNode" upper="0.0015">0.0015</parameter>
        <parameter id="kappa.s:alignedSegment1" spec="parameter.RealParameter" lower="0.0" name="stateNode">2.0</parameter>
        <parameter id="popSizeCwR.alltrees" spec="parameter.RealParameter" name="stateNode">1.0</parameter>
        <stateNode id="networkCwR.alltrees" spec="coalre.simulator.SimulatedCoalescentNetwork" enableSegmentTreeUpdate="false" nSegments="8" traitSet="@dateTrait.t:alignedSegment1">
            <parameter id="RealParameter.10" spec="parameter.RealParameter" name="reassortmentRate">0.0</parameter>
            <populationModel id="ConstantPopulation.0" spec="ConstantPopulation">
                <parameter id="RealParameter.11" spec="parameter.RealParameter" name="popSize">1.0</parameter>
            </populationModel>
            <taxonSet id="TaxonSet.8" spec="TaxonSet" alignment="@alignedSegment1"/>
        </stateNode>
        <parameter id="freqParameter.s:alignedSegment1" spec="parameter.RealParameter" dimension="4" lower="0.0" name="stateNode" upper="1.0">0.25</parameter>
    </state>

    <init id="segmentTreeInitializerCwR.t:alignedSegment8" spec="coalre.network.SegmentTreeInitializer" network="@networkCwR.alltrees" segmentIndex="7">
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </init>

    <init id="segmentTreeInitializerCwR.t:alignedSegment7" spec="coalre.network.SegmentTreeInitializer" network="@networkCwR.alltrees" segmentIndex="6">
        <segmentTree idref="Tree.t:alignedSegment7"/>
    </init>

    <init id="segmentTreeInitializerCwR.t:alignedSegment6" spec="coalre.network.SegmentTreeInitializer" network="@networkCwR.alltrees" segmentIndex="5">
        <segmentTree idref="Tree.t:alignedSegment6"/>
    </init>

    <init id="segmentTreeInitializerCwR.t:alignedSegment5" spec="coalre.network.SegmentTreeInitializer" network="@networkCwR.alltrees" segmentIndex="4">
        <segmentTree idref="Tree.t:alignedSegment5"/>
    </init>

    <init id="segmentTreeInitializerCwR.t:alignedSegment4" spec="coalre.network.SegmentTreeInitializer" network="@networkCwR.alltrees" segmentIndex="3">
        <segmentTree idref="Tree.t:alignedSegment4"/>
    </init>

    <init id="segmentTreeInitializerCwR.t:alignedSegment3" spec="coalre.network.SegmentTreeInitializer" network="@networkCwR.alltrees" segmentIndex="2">
        <segmentTree idref="Tree.t:alignedSegment3"/>
    </init>

    <init id="segmentTreeInitializerCwR.t:alignedSegment2" spec="coalre.network.SegmentTreeInitializer" network="@networkCwR.alltrees" segmentIndex="1">
        <segmentTree idref="Tree.t:alignedSegment2"/>
    </init>

    <init id="segmentTreeInitializerCwR.t:alignedSegment1" spec="coalre.network.SegmentTreeInitializer" network="@networkCwR.alltrees" segmentIndex="0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
    </init>

    <distribution id="posterior" spec="util.CompoundDistribution">
        <distribution id="prior" spec="util.CompoundDistribution">
            <distribution id="CoalescentWithReassortmentDummy.t:alignedSegment1" spec="coalre.util.DummyTreeDistribution" tree="@Tree.t:alignedSegment1"/>
            <distribution id="CoalescentWithReassortmentDummy.t:alignedSegment2" spec="coalre.util.DummyTreeDistribution" tree="@Tree.t:alignedSegment2"/>
            <distribution id="CoalescentWithReassortmentDummy.t:alignedSegment3" spec="coalre.util.DummyTreeDistribution" tree="@Tree.t:alignedSegment3"/>
            <distribution id="CoalescentWithReassortmentDummy.t:alignedSegment4" spec="coalre.util.DummyTreeDistribution" tree="@Tree.t:alignedSegment4"/>
            <distribution id="CoalescentWithReassortmentDummy.t:alignedSegment5" spec="coalre.util.DummyTreeDistribution" tree="@Tree.t:alignedSegment5"/>
            <distribution id="CoalescentWithReassortmentDummy.t:alignedSegment6" spec="coalre.util.DummyTreeDistribution" tree="@Tree.t:alignedSegment6"/>
            <distribution id="CoalescentWithReassortmentDummy.t:alignedSegment7" spec="coalre.util.DummyTreeDistribution" tree="@Tree.t:alignedSegment7"/>
            <distribution id="CoalescentWithReassortmentDummy.t:alignedSegment8" spec="coalre.util.DummyTreeDistribution" tree="@Tree.t:alignedSegment8"/>
            <distribution id="CoalescentWithReassortmentPrior.alltrees" spec="coalre.distribution.CoalescentWithReassortment">
                <parameter id="reassortmentRateCwR.alltrees" spec="parameter.RealParameter" estimate="false" name="reassortmentRate">0.001</parameter>
                <populationModel id="constantPopSizeCwR.alltrees" spec="ConstantPopulation" popSize="@popSizeCwR.alltrees"/>
                <networkIntervals id="networkIntervalsCwR.alltrees" spec="coalre.distribution.NetworkIntervals" network="@networkCwR.alltrees">
                    <parameter id="binomialProbCwR.alltrees" spec="parameter.RealParameter" estimate="false" lower="0.0" name="binomialProb" upper="1.0">0.5</parameter>
                </networkIntervals>
            </distribution>
            <prior id="ClockPrior.c:alignedSegment1" name="distribution" x="@clockRate.c:alignedSegment1">
                <Uniform id="Uniform.0" name="distr" upper="Infinity"/>
            </prior>
            <prior id="ClockPrior.c:alignedSegment2" name="distribution" x="@clockRate.c:alignedSegment2">
                <Uniform id="Uniform.3" name="distr" upper="Infinity"/>
            </prior>
            <prior id="ClockPrior.c:alignedSegment3" name="distribution" x="@clockRate.c:alignedSegment3">
                <Uniform id="Uniform.3.alignedSegment3" name="distr" upper="Infinity"/>
            </prior>
            <prior id="ClockPrior.c:alignedSegment4" name="distribution" x="@clockRate.c:alignedSegment4">
                <Uniform id="Uniform.3.alignedSegment4" name="distr" upper="Infinity"/>
            </prior>
            <prior id="ClockPrior.c:alignedSegment5" name="distribution" x="@clockRate.c:alignedSegment5">
                <Uniform id="Uniform.3.alignedSegment5" name="distr" upper="Infinity"/>
            </prior>
            <prior id="ClockPrior.c:alignedSegment6" name="distribution" x="@clockRate.c:alignedSegment6">
                <Uniform id="Uniform.3.alignedSegment6" name="distr" upper="Infinity"/>
            </prior>
            <prior id="ClockPrior.c:alignedSegment7" name="distribution" x="@clockRate.c:alignedSegment7">
                <Uniform id="Uniform.3.alignedSegment7" name="distr" upper="Infinity"/>
            </prior>
            <prior id="ClockPrior.c:alignedSegment8" name="distribution" x="@clockRate.c:alignedSegment8">
                <Uniform id="Uniform.3.alignedSegment8" name="distr" upper="Infinity"/>
            </prior>
            <prior id="FrequenciesPrior.s:alignedSegment1" name="distribution" x="@freqParameter.s:alignedSegment1">
                <Uniform id="Uniform.24" name="distr"/>
            </prior>
            <prior id="KappaPrior.s:alignedSegment1" name="distribution" x="@kappa.s:alignedSegment1">
                <LogNormal id="LogNormalDistributionModel.0" name="distr">
                    <parameter id="RealParameter.8" spec="parameter.RealParameter" estimate="false" name="M">1.0</parameter>
                    <parameter id="RealParameter.9" spec="parameter.RealParameter" estimate="false" name="S">1.25</parameter>
                </LogNormal>
            </prior>
            <prior id="popSizeCwRPrior.alltrees" name="distribution" x="@popSizeCwR.alltrees">
                <OneOnX id="OneOnX.8" name="distr"/>
            </prior>
        </distribution>
        <distribution id="likelihood" spec="util.CompoundDistribution" useThreads="true">
            <distribution id="treeLikelihood.alignedSegment1" spec="ThreadedTreeLikelihood" data="@alignedSegment1" tree="@Tree.t:alignedSegment1">
                <siteModel id="SiteModel.s:alignedSegment1" spec="SiteModel">
                    <parameter id="mutationRate.s:alignedSegment1" spec="parameter.RealParameter" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:alignedSegment1" spec="parameter.RealParameter" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:alignedSegment1" spec="parameter.RealParameter" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="hky.s:alignedSegment1" spec="HKY" kappa="@kappa.s:alignedSegment1">
                        <frequencies id="estimatedFreqs.s:alignedSegment1" spec="Frequencies" frequencies="@freqParameter.s:alignedSegment1"/>
                    </substModel>
                </siteModel>
                <branchRateModel id="StrictClock.c:alignedSegment1" spec="beast.evolution.branchratemodel.StrictClockModel" clock.rate="@clockRate.c:alignedSegment1"/>
            </distribution>
            <distribution id="treeLikelihood.alignedSegment2" spec="ThreadedTreeLikelihood" data="@alignedSegment2" tree="@Tree.t:alignedSegment2">
                <siteModel id="SiteModel.s:alignedSegment2" spec="SiteModel">
                    <parameter id="mutationRate.s:alignedSegment2" spec="parameter.RealParameter" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:alignedSegment2" spec="parameter.RealParameter" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:alignedSegment2" spec="parameter.RealParameter" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="JC69.s:alignedSegment2" spec="JukesCantor"/>
                </siteModel>
                <branchRateModel id="StrictClock.c:alignedSegment2" spec="beast.evolution.branchratemodel.StrictClockModel" clock.rate="@clockRate.c:alignedSegment2"/>
            </distribution>
            <distribution id="treeLikelihood.alignedSegment3" spec="ThreadedTreeLikelihood" data="@alignedSegment3" tree="@Tree.t:alignedSegment3">
                <siteModel id="SiteModel.s:alignedSegment3" spec="SiteModel">
                    <parameter id="mutationRate.s:alignedSegment3" spec="parameter.RealParameter" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:alignedSegment3" spec="parameter.RealParameter" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:alignedSegment3" spec="parameter.RealParameter" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="JC69.s:alignedSegment3" spec="JukesCantor"/>
                </siteModel>
                <branchRateModel id="StrictClock.c:alignedSegment3" spec="beast.evolution.branchratemodel.StrictClockModel" clock.rate="@clockRate.c:alignedSegment3"/>
            </distribution>
            <distribution id="treeLikelihood.alignedSegment4" spec="ThreadedTreeLikelihood" data="@alignedSegment4" tree="@Tree.t:alignedSegment4">
                <siteModel id="SiteModel.s:alignedSegment4" spec="SiteModel">
                    <parameter id="mutationRate.s:alignedSegment4" spec="parameter.RealParameter" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:alignedSegment4" spec="parameter.RealParameter" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:alignedSegment4" spec="parameter.RealParameter" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="JC69.s:alignedSegment4" spec="JukesCantor"/>
                </siteModel>
                <branchRateModel id="StrictClock.c:alignedSegment4" spec="beast.evolution.branchratemodel.StrictClockModel" clock.rate="@clockRate.c:alignedSegment4"/>
            </distribution>
            <distribution id="treeLikelihood.alignedSegment5" spec="ThreadedTreeLikelihood" data="@alignedSegment5" tree="@Tree.t:alignedSegment5">
                <siteModel id="SiteModel.s:alignedSegment5" spec="SiteModel">
                    <parameter id="mutationRate.s:alignedSegment5" spec="parameter.RealParameter" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:alignedSegment5" spec="parameter.RealParameter" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:alignedSegment5" spec="parameter.RealParameter" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="JC69.s:alignedSegment5" spec="JukesCantor"/>
                </siteModel>
                <branchRateModel id="StrictClock.c:alignedSegment5" spec="beast.evolution.branchratemodel.StrictClockModel" clock.rate="@clockRate.c:alignedSegment5"/>
            </distribution>
            <distribution id="treeLikelihood.alignedSegment6" spec="ThreadedTreeLikelihood" data="@alignedSegment6" tree="@Tree.t:alignedSegment6">
                <siteModel id="SiteModel.s:alignedSegment6" spec="SiteModel">
                    <parameter id="mutationRate.s:alignedSegment6" spec="parameter.RealParameter" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:alignedSegment6" spec="parameter.RealParameter" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:alignedSegment6" spec="parameter.RealParameter" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="JC69.s:alignedSegment6" spec="JukesCantor"/>
                </siteModel>
                <branchRateModel id="StrictClock.c:alignedSegment6" spec="beast.evolution.branchratemodel.StrictClockModel" clock.rate="@clockRate.c:alignedSegment6"/>
            </distribution>
            <distribution id="treeLikelihood.alignedSegment7" spec="ThreadedTreeLikelihood" data="@alignedSegment7" tree="@Tree.t:alignedSegment7">
                <siteModel id="SiteModel.s:alignedSegment7" spec="SiteModel">
                    <parameter id="mutationRate.s:alignedSegment7" spec="parameter.RealParameter" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:alignedSegment7" spec="parameter.RealParameter" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:alignedSegment7" spec="parameter.RealParameter" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="JC69.s:alignedSegment7" spec="JukesCantor"/>
                </siteModel>
                <branchRateModel id="StrictClock.c:alignedSegment7" spec="beast.evolution.branchratemodel.StrictClockModel" clock.rate="@clockRate.c:alignedSegment7"/>
            </distribution>
            <distribution id="treeLikelihood.alignedSegment8" spec="ThreadedTreeLikelihood" data="@alignedSegment8" tree="@Tree.t:alignedSegment8">
                <siteModel id="SiteModel.s:alignedSegment8" spec="SiteModel">
                    <parameter id="mutationRate.s:alignedSegment8" spec="parameter.RealParameter" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:alignedSegment8" spec="parameter.RealParameter" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:alignedSegment8" spec="parameter.RealParameter" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="JC69.s:alignedSegment8" spec="JukesCantor"/>
                </siteModel>
                <branchRateModel id="StrictClock.c:alignedSegment8" spec="beast.evolution.branchratemodel.StrictClockModel" clock.rate="@clockRate.c:alignedSegment8"/>
            </distribution>
        </distribution>
    </distribution>

    <operator id="StrictClockRateScaler.c:alignedSegment4" spec="ScaleOperator" parameter="@clockRate.c:alignedSegment4" weight="3.0"/>

    <operator id="strictClockUpDownOperator.c:alignedSegment4" spec="UpDownOperator" scaleFactor="0.75" weight="3.0">
        <up idref="clockRate.c:alignedSegment4"/>
    </operator>

    <operator id="StrictClockRateScaler.c:alignedSegment5" spec="ScaleOperator" parameter="@clockRate.c:alignedSegment5" weight="3.0"/>

    <operator id="strictClockUpDownOperator.c:alignedSegment5" spec="UpDownOperator" scaleFactor="0.75" weight="3.0">
        <up idref="clockRate.c:alignedSegment5"/>
    </operator>

    <operator id="StrictClockRateScaler.c:alignedSegment7" spec="ScaleOperator" parameter="@clockRate.c:alignedSegment7" weight="3.0"/>

    <operator id="strictClockUpDownOperator.c:alignedSegment7" spec="UpDownOperator" scaleFactor="0.75" weight="3.0">
        <up idref="clockRate.c:alignedSegment7"/>
    </operator>

    <operator id="StrictClockRateScaler.c:alignedSegment3" spec="ScaleOperator" parameter="@clockRate.c:alignedSegment3" weight="3.0"/>

    <operator id="strictClockUpDownOperator.c:alignedSegment3" spec="UpDownOperator" scaleFactor="0.75" weight="3.0">
        <up idref="clockRate.c:alignedSegment3"/>
    </operator>

    <operator id="StrictClockRateScaler.c:alignedSegment2" spec="ScaleOperator" parameter="@clockRate.c:alignedSegment2" weight="3.0"/>

    <operator id="strictClockUpDownOperator.c:alignedSegment2" spec="UpDownOperator" scaleFactor="0.75" weight="3.0">
        <up idref="clockRate.c:alignedSegment2"/>
    </operator>

    <operator id="StrictClockRateScaler.c:alignedSegment6" spec="ScaleOperator" parameter="@clockRate.c:alignedSegment6" weight="3.0"/>

    <operator id="strictClockUpDownOperator.c:alignedSegment6" spec="UpDownOperator" scaleFactor="0.75" weight="3.0">
        <up idref="clockRate.c:alignedSegment6"/>
    </operator>

    <operator id="StrictClockRateScaler.c:alignedSegment8" spec="ScaleOperator" parameter="@clockRate.c:alignedSegment8" weight="3.0"/>

    <operator id="strictClockUpDownOperator.c:alignedSegment8" spec="UpDownOperator" scaleFactor="0.75" weight="3.0">
        <up idref="clockRate.c:alignedSegment8"/>
    </operator>

    <operator id="StrictClockRateScaler.c:alignedSegment1" spec="ScaleOperator" parameter="@clockRate.c:alignedSegment1" weight="3.0"/>

    <operator id="strictClockUpDownOperator.c:alignedSegment1" spec="UpDownOperator" scaleFactor="0.75" weight="3.0">
        <up idref="clockRate.c:alignedSegment1"/>
    </operator>

    <operator id="KappaScaler.s:alignedSegment1" spec="ScaleOperator" parameter="@kappa.s:alignedSegment1" scaleFactor="0.5" weight="0.1"/>

    <operator id="popSizeCwRScale.alltrees" spec="ScaleOperator" parameter="@popSizeCwR.alltrees" scaleFactor="0.5" weight="1.0"/>

    <operator id="addRemoveReassortmentCwR.alltrees" spec="coalre.operators.AddRemoveReassortment" alpha="1.0" network="@networkCwR.alltrees" weight="30.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="divertSegmentCwR.alltrees" spec="coalre.operators.DivertSegmentOperator" network="@networkCwR.alltrees" weight="5.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="uniformNetworkCwR.alltrees" spec="coalre.operators.UniformNetworkNodeHeightOperator" network="@networkCwR.alltrees" weight="5.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="networkWideExchangeCwR.alltrees" spec="coalre.operators.NetworkExchange" isNarrow="false" network="@networkCwR.alltrees" weight="5.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="networkNarrowExchangeCwR.alltrees" spec="coalre.operators.NetworkExchange" network="@networkCwR.alltrees" weight="15.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="subNetworkSlideCwR.alltrees" spec="coalre.operators.SubNetworkSlide" network="@networkCwR.alltrees" weight="30.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="networkGibbsCwR.alltrees" spec="coalre.operators.GibbsOperatorAboveSegmentRoots" network="@networkCwR.alltrees" populationModel="@constantPopSizeCwR.alltrees" reassortmentRate="@reassortmentRateCwR.alltrees" weight="5.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="networkScaleCwR.alltrees" spec="coalre.operators.NetworkScaleOperator" network="@networkCwR.alltrees" weight="3.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="networkScaleRootCwR.alltrees" spec="coalre.operators.NetworkScaleOperator" network="@networkCwR.alltrees" scaleRootOnly="true" weight="3.0">
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="networkUpDownCwR.alltrees" spec="coalre.operators.NetworkScaleOperator" network="@networkCwR.alltrees" weight="3.0">
        <upParameter idref="popSizeCwR.alltrees"/>
        <downParameter idref="clockRate.c:alignedSegment3"/>
        <downParameter idref="clockRate.c:alignedSegment4"/>
        <downParameter idref="clockRate.c:alignedSegment2"/>
        <downParameter idref="clockRate.c:alignedSegment7"/>
        <downParameter idref="clockRate.c:alignedSegment5"/>
        <downParameter idref="clockRate.c:alignedSegment8"/>
        <downParameter idref="clockRate.c:alignedSegment6"/>
        <downParameter idref="clockRate.c:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment1"/>
        <segmentTree idref="Tree.t:alignedSegment2"/>
        <segmentTree idref="Tree.t:alignedSegment3"/>
        <segmentTree idref="Tree.t:alignedSegment4"/>
        <segmentTree idref="Tree.t:alignedSegment5"/>
        <segmentTree idref="Tree.t:alignedSegment6"/>
        <segmentTree idref="Tree.t:alignedSegment7"/>
        <segmentTree idref="Tree.t:alignedSegment8"/>
    </operator>

    <operator id="FrequenciesExchanger.s:alignedSegment1" spec="DeltaExchangeOperator" delta="0.01" weight="0.1">
        <parameter idref="freqParameter.s:alignedSegment1"/>
    </operator>

    <logger id="tracelog" spec="Logger" fileName="alignedSegment1.log" logEvery="1000" model="@posterior" sanitiseHeaders="true" sort="smart">
        <log idref="posterior"/>
        <log idref="likelihood"/>
        <log idref="prior"/>
        <log idref="treeLikelihood.alignedSegment1"/>
        <log id="TreeHeight.t:alignedSegment1" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:alignedSegment1"/>
        <log idref="treeLikelihood.alignedSegment4"/>
        <log id="TreeHeight.t:alignedSegment4" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:alignedSegment4"/>
        <log idref="clockRate.c:alignedSegment4"/>
        <log idref="treeLikelihood.alignedSegment5"/>
        <log id="TreeHeight.t:alignedSegment5" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:alignedSegment5"/>
        <log idref="clockRate.c:alignedSegment5"/>
        <log idref="treeLikelihood.alignedSegment7"/>
        <log id="TreeHeight.t:alignedSegment7" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:alignedSegment7"/>
        <log idref="clockRate.c:alignedSegment7"/>
        <log idref="treeLikelihood.alignedSegment3"/>
        <log id="TreeHeight.t:alignedSegment3" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:alignedSegment3"/>
        <log idref="clockRate.c:alignedSegment3"/>
        <log idref="treeLikelihood.alignedSegment2"/>
        <log id="TreeHeight.t:alignedSegment2" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:alignedSegment2"/>
        <log idref="clockRate.c:alignedSegment2"/>
        <log idref="treeLikelihood.alignedSegment6"/>
        <log id="TreeHeight.t:alignedSegment6" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:alignedSegment6"/>
        <log idref="clockRate.c:alignedSegment6"/>
        <log idref="treeLikelihood.alignedSegment8"/>
        <log id="TreeHeight.t:alignedSegment8" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:alignedSegment8"/>
        <log idref="clockRate.c:alignedSegment8"/>
        <log idref="clockRate.c:alignedSegment1"/>
        <log idref="kappa.s:alignedSegment1"/>
        <log idref="popSizeCwR.alltrees"/>
        <log id="networkCwRStatsLogger.alltrees" spec="coalre.statistics.NetworkStatsLogger" network="@networkCwR.alltrees"/>
        <log idref="freqParameter.s:alignedSegment1"/>
    </logger>

    <logger id="screenlog" spec="Logger" logEvery="1000">
        <log idref="posterior"/>
        <log idref="likelihood"/>
        <log idref="prior"/>
    </logger>

    <logger id="treelog.t:alignedSegment1" spec="Logger" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:alignedSegment1" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:alignedSegment1"/>
    </logger>

    <logger id="treelog.t:alignedSegment4" spec="Logger" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:alignedSegment4" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:alignedSegment4"/>
    </logger>

    <logger id="treelog.t:alignedSegment5" spec="Logger" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:alignedSegment5" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:alignedSegment5"/>
    </logger>

    <logger id="treelog.t:alignedSegment7" spec="Logger" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:alignedSegment7" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:alignedSegment7"/>
    </logger>

    <logger id="treelog.t:alignedSegment3" spec="Logger" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:alignedSegment3" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:alignedSegment3"/>
    </logger>

    <logger id="treelog.t:alignedSegment2" spec="Logger" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:alignedSegment2" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:alignedSegment2"/>
    </logger>

    <logger id="treelog.t:alignedSegment6" spec="Logger" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:alignedSegment6" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:alignedSegment6"/>
    </logger>

    <logger id="treelog.t:alignedSegment8" spec="Logger" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:alignedSegment8" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:alignedSegment8"/>
    </logger>

    <logger id="networkCwRLogger.alltrees" spec="Logger" fileName="$(filebase).network.trees" logEvery="10000" mode="tree">
        <log idref="networkCwR.alltrees"/>
    </logger>

    <operatorschedule id="OperatorSchedule" spec="OperatorSchedule"/>

</run>

</beast>